ID: 1002805230

View in Genome Browser
Species Human (GRCh38)
Location 6:567267-567289
Sequence AGGACGCCTGCAGCACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002805230_1002805234 -8 Left 1002805230 6:567267-567289 CCTCCTGGTGCTGCAGGCGTCCT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1002805234 6:567282-567304 GGCGTCCTTCTCGCTGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1002805230_1002805238 18 Left 1002805230 6:567267-567289 CCTCCTGGTGCTGCAGGCGTCCT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1002805238 6:567308-567330 GCTTCCCCCCATCCTCTGTGTGG No data
1002805230_1002805232 -10 Left 1002805230 6:567267-567289 CCTCCTGGTGCTGCAGGCGTCCT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1002805232 6:567280-567302 CAGGCGTCCTTCTCGCTGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1002805230_1002805233 -9 Left 1002805230 6:567267-567289 CCTCCTGGTGCTGCAGGCGTCCT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1002805233 6:567281-567303 AGGCGTCCTTCTCGCTGCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002805230 Original CRISPR AGGACGCCTGCAGCACCAGG AGG (reversed) Intronic
901059489 1:6465533-6465555 GGGCCCCCAGCAGCACCAGGAGG + Exonic
902288735 1:15423155-15423177 AGAACCCCTCCAGCTCCAGGTGG + Intronic
902456380 1:16536522-16536544 AAGAGGCCTGAAGCTCCAGGAGG - Intergenic
902495783 1:16871389-16871411 AAGAGGCCTGAAGCTCCAGGAGG + Intronic
904586659 1:31584540-31584562 TGGAATCCTGCAGCAGCAGGAGG + Intronic
904629584 1:31830863-31830885 AGGCTGCCAGCAGCACCTGGCGG - Intergenic
909814228 1:79970976-79970998 AGGCACCCTGCAGCACCAGAAGG + Intergenic
913661718 1:121010771-121010793 AAGAAGCCTGAAGCTCCAGGAGG - Intergenic
914013090 1:143793951-143793973 AAGAAGCCTGAAGCTCCAGGAGG - Intergenic
914164736 1:145167234-145167256 AAGAAGCCTGAAGCTCCAGGAGG + Intergenic
914651714 1:149702560-149702582 AAGAAGCCTGAAGCTCCAGGAGG - Exonic
914830108 1:151165126-151165148 AAGACGCCTGGAGCATCAGTTGG - Exonic
916183765 1:162111383-162111405 ACCACGCCTACATCACCAGGGGG - Intronic
920059798 1:203219432-203219454 AGGAAGCCTGGAGAATCAGGAGG + Intronic
920375574 1:205506070-205506092 AGGATGCCTGGAGCGCCTGGTGG + Intronic
920654257 1:207863979-207864001 AGGAGGCCAGCAGCAGGAGGAGG - Intergenic
921301272 1:213753636-213753658 AAGCTGCCTGCAGCATCAGGTGG - Intergenic
921514059 1:216068020-216068042 AGGGCCCCTGGAGAACCAGGAGG + Intronic
922605757 1:226888931-226888953 AGGCCTGCTGCAGCACCAGAGGG - Exonic
1063053550 10:2478556-2478578 AGAACGGCTCCATCACCAGGAGG + Intergenic
1063262714 10:4408458-4408480 AGGAAGCCTGCAGCCCCCGAAGG + Intergenic
1063950003 10:11213322-11213344 AGGTCAGCTGCAGCACCAGATGG - Intronic
1067348252 10:45453852-45453874 TGGAGGCCTGCAGCTCCAGGTGG - Intergenic
1067527765 10:47048628-47048650 AGGCCGCCTGCAACACCGAGAGG + Intergenic
1067849578 10:49746158-49746180 GGGACGGCAGCAGCACCAGCCGG + Intronic
1068334383 10:55613299-55613321 AGGAAGCCTGGATCACAAGGCGG - Intronic
1069884995 10:71618213-71618235 AAGACCCCTGCATCACCAGGGGG + Intronic
1073349377 10:102809024-102809046 AGGACGCCTCCAGCACCTTGGGG - Intronic
1077043959 11:536144-536166 AGGACGCTTGCAGCCCCGGTGGG + Intronic
1077197332 11:1288050-1288072 AGGGCACCTGCAGCTCCTGGGGG - Intronic
1079844013 11:25441155-25441177 AGCATGCCTGCATCATCAGGAGG + Intergenic
1079913541 11:26339921-26339943 AGGAAGCCTGCAGCAGCTGCAGG + Intronic
1080330136 11:31127465-31127487 AGGAGGCCTGCAGCTTAAGGTGG - Intronic
1081811060 11:45914355-45914377 TGGTCTCCTGCAGCCCCAGGGGG + Exonic
1084399880 11:68937340-68937362 AGCATGTCTGCAGCAGCAGGAGG + Intronic
1084576771 11:69993668-69993690 GGGGCGCCAGCTGCACCAGGTGG - Intergenic
1085724516 11:78942527-78942549 AGGCCGCCTGCAGCCCCGGACGG - Intronic
1088705947 11:112464861-112464883 AGGCCGTCTGCAGCACCGGGAGG - Intergenic
1091579077 12:1770005-1770027 AGGACTCCTTGAGCCCCAGGAGG - Intronic
1092233728 12:6792639-6792661 AGCACGCCTGCAGCCCAGGGTGG - Intronic
1094375983 12:29787685-29787707 AGCCCGGCTGCAGCCCCAGGAGG + Intergenic
1096983898 12:55744129-55744151 AGGACCCCCGCAGCCCCAGCTGG + Intronic
1097194299 12:57235313-57235335 AGGAGGCAGGCAGCACCAGCAGG - Exonic
1097624068 12:61978707-61978729 AGAACGCCTGGAGAAGCAGGAGG + Intronic
1098171727 12:67753679-67753701 AGGAAGCCCGCAGCAGCAGCAGG + Intergenic
1101589352 12:106112327-106112349 AGGCCGCCTGCAGCAGGAGCAGG + Intronic
1101900342 12:108787308-108787330 AGGGCGCCTGCACCACCATTCGG + Exonic
1102740140 12:115199708-115199730 GGGACCCCTGCAGCTCAAGGAGG - Intergenic
1103926488 12:124426375-124426397 AGGATGCTGGCAGCACCAGCTGG + Intronic
1104572354 12:129936004-129936026 GGGATGCCTGCAGGACCAGCGGG + Intergenic
1104831563 12:131755866-131755888 AGGACACCCCCAGCACCAGCTGG - Intronic
1113932061 13:113973847-113973869 GGGAGGCCTGCAGCCCGAGGGGG - Intergenic
1117276739 14:54201756-54201778 ATGGAGCCTGCAGCACCTGGTGG + Intergenic
1117276779 14:54201979-54202001 AAGACCCCTGCACCAACAGGTGG + Intergenic
1117462376 14:55957960-55957982 AGGACATGTTCAGCACCAGGAGG + Intergenic
1118223168 14:63874395-63874417 AAGAGGCCTGCAGAGCCAGGAGG - Intronic
1119618017 14:76111638-76111660 TGGGCGGCTGCAGCACCACGGGG - Intergenic
1122229543 14:100298870-100298892 AGCACGCCTGCCACACCTGGAGG + Exonic
1122400942 14:101466978-101467000 AGGACATCAGCAGCACCAGGGGG + Intergenic
1122778022 14:104131381-104131403 AGGACGTGTGTAGCACCAAGTGG - Intergenic
1123054910 14:105564751-105564773 AGGAAGCCCCCAGCCCCAGGCGG + Intergenic
1123079353 14:105684330-105684352 AGGAAGCCCCCAGCCCCAGGCGG + Intergenic
1124055253 15:26235973-26235995 AGAAAGCCTGCAGGGCCAGGTGG - Intergenic
1124917224 15:33987655-33987677 AGGAGGCCTGCAGATGCAGGTGG - Intronic
1125996740 15:44168882-44168904 AGGAGGCTTGTAGCAGCAGGTGG - Intronic
1127578713 15:60317189-60317211 AGGACTCCTGCAACACCCTGGGG + Intergenic
1128304013 15:66586398-66586420 AGTACGCCTCCAGCACCGAGGGG + Intronic
1132198169 15:99929415-99929437 AGAAGGCCGACAGCACCAGGAGG + Intergenic
1132522377 16:397612-397634 AGGCCGGCTGCAGCACTGGGCGG + Intronic
1132761135 16:1509155-1509177 TGGGGGCCTGAAGCACCAGGAGG + Intronic
1132797695 16:1733442-1733464 ATGACGACGGCAGCATCAGGCGG - Intronic
1132996801 16:2827696-2827718 AGGACTCCAGAAGCACCAGCTGG - Intergenic
1135277926 16:21129227-21129249 AGGACCCAAGCAGCAGCAGGTGG - Intronic
1138339419 16:56278986-56279008 TGGACTCCTGCAGCATAAGGTGG - Intronic
1139952311 16:70678383-70678405 AGGAGACCTGCAGCCCCAGCTGG - Exonic
1141963202 16:87423289-87423311 AGGACCACTTGAGCACCAGGAGG + Intronic
1142187728 16:88702352-88702374 AGGAAGGCTACAGCACCCGGGGG + Intronic
1143680840 17:8475009-8475031 AGGGCGCCGGCAGAGCCAGGCGG + Exonic
1143898652 17:10156774-10156796 GGGAGGCCTGCAGCAGGAGGGGG - Intronic
1145190188 17:20834245-20834267 AGGAAGCCTGGATCACAAGGTGG - Intergenic
1145401387 17:22538128-22538150 AGGAAGCCTGGATCACAAGGTGG - Intergenic
1146269212 17:31473546-31473568 AGAGCCCCTGCAGCACCTGGAGG + Intronic
1147875700 17:43618915-43618937 AGGAGCTCTGCAGCACCAGCAGG + Intergenic
1148464414 17:47856453-47856475 AGGACTCCTGGAACTCCAGGAGG + Intergenic
1148802110 17:50235759-50235781 AGCACACAAGCAGCACCAGGAGG - Intergenic
1150593114 17:66580332-66580354 AGGAATGCTGCAGCACCAGCAGG - Intronic
1150942484 17:69707713-69707735 AGGTCACCTGCAGCATCAGGGGG - Intergenic
1151471080 17:74318154-74318176 GGGACGCCTGCAGCACTGGTGGG + Intergenic
1152420054 17:80187810-80187832 AGGAGGCCAGCAGGACCTGGTGG + Intronic
1154348227 18:13562012-13562034 GGGATGCCTCCAACACCAGGTGG - Intronic
1156447902 18:37250461-37250483 AGAAAGCCTGCACCACCATGGGG + Intronic
1157098410 18:44708185-44708207 AGGACACTTGAACCACCAGGAGG - Intronic
1161085337 19:2332629-2332651 AGGAGCCCTGCAGCCCCAGAAGG + Intronic
1161115425 19:2494174-2494196 ATGAGGCCTGCAGCTCCAGACGG + Intergenic
1161290605 19:3491740-3491762 GGGACAGCTGCAGCACGAGGCGG - Exonic
1162033466 19:7927043-7927065 AGGACGGCTGCAAGACCAGCTGG - Exonic
1163406903 19:17128520-17128542 AGGACGCCTGAGGGACCGGGGGG - Intronic
1165169876 19:33884393-33884415 AGGAAGCCTGGAGGAGCAGGCGG - Intergenic
1165758505 19:38307718-38307740 AGCTCGCTTGCAGCCCCAGGAGG + Exonic
1165990639 19:39810601-39810623 ATGACACCTGCATCACCAGATGG + Intergenic
1168296084 19:55377908-55377930 CGGGCGCCTGCACCCCCAGGGGG + Intronic
1202707274 1_KI270713v1_random:32878-32900 AAGAGGCCTGAAGCTCCAGGAGG - Intergenic
927192305 2:20525036-20525058 AGGACAACTGCATCCCCAGGAGG + Intergenic
928023494 2:27721724-27721746 AGGACGCTTCCTGCTCCAGGTGG - Intergenic
929494169 2:42425039-42425061 AGCAGGCCCGCAGCGCCAGGAGG - Intronic
933701389 2:85257723-85257745 AGGAGGGCAGCAGCACCTGGTGG - Intronic
934920397 2:98339824-98339846 AGAAGGGCTGCAGCACCAGAAGG + Intronic
938447305 2:131388995-131389017 AGGAGCCCTGGAGCATCAGGAGG - Intergenic
938723410 2:134086000-134086022 TGGACGCCTGTAGTCCCAGGAGG + Intergenic
948567107 2:238894263-238894285 AGGACTCCAGCAGCTCCACGTGG + Intronic
948790820 2:240375985-240376007 AGCCCTCCTGCTGCACCAGGGGG - Intergenic
948897546 2:240934334-240934356 AGGCCGCCTGCAGCAGCTGGAGG + Intronic
949021258 2:241742609-241742631 AGAACTCCACCAGCACCAGGAGG - Intronic
1169140195 20:3223420-3223442 AGTACTCCTGCAGCTCCAGCAGG - Exonic
1172936630 20:38625094-38625116 AGGAGGTCTGCATCACCACGTGG - Intronic
1174309105 20:49636566-49636588 AGCACTTCTGCAGCACAAGGTGG + Intronic
1175818396 20:61895654-61895676 AGGGCAGCTGCACCACCAGGAGG + Intronic
1175900152 20:62356845-62356867 AGGACGCCAGCTGCTCCTGGAGG + Intronic
1179552254 21:42150754-42150776 AGGAAGCCAGCATCACCAGGTGG + Intergenic
1180093405 21:45543521-45543543 AGCACCCCCGCAACACCAGGAGG - Intronic
1180352845 22:11818488-11818510 AGGAAACCTGCAGCACCCAGGGG - Intergenic
1180385397 22:12173869-12173891 AGGAAACCTGCAGCACCCAGGGG + Intergenic
1182688885 22:32142150-32142172 AGGGCCCCTGAAGCACCATGGGG + Intergenic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
952815519 3:37443871-37443893 AGGGCACCTGAAGCACCTGGGGG + Intergenic
955200201 3:56845058-56845080 AGGCCACCTTCAGCTCCAGGAGG - Intronic
957028545 3:75213873-75213895 ATGAAGCCTGGAGCACCTGGAGG + Intergenic
958977449 3:100683095-100683117 AGGACACCTGCAGCCGCAGTGGG - Intronic
961167495 3:124773689-124773711 CGGATGCATGCAGCACCAAGAGG - Exonic
964710716 3:159668517-159668539 AGGAAACCTGGAGGACCAGGTGG + Intronic
964732638 3:159883479-159883501 AGGCCTTCAGCAGCACCAGGTGG + Intronic
966735301 3:183182335-183182357 GGGATGCCTGGAGCACCACGGGG + Intronic
966767775 3:183478517-183478539 GGGATGCCTGGAGCACCACGGGG - Intergenic
967171081 3:186824410-186824432 GGGACGCCTGGAGCACCATGGGG - Intergenic
978367330 4:107996023-107996045 AGAACAACTGCAGCAACAGGAGG - Intronic
980180363 4:129393499-129393521 AGGCCGGCTGCTGCAGCAGGTGG - Intergenic
980824429 4:138056857-138056879 GGGACTCCAGCAGCTCCAGGTGG - Intergenic
981695029 4:147551387-147551409 ATAAAGCCTGCAGAACCAGGAGG - Intergenic
988805197 5:34733883-34733905 AGGACCCCTGCAGTAGTAGGAGG - Intronic
992494930 5:77282643-77282665 TGGACTCCTGCAGCAGCTGGAGG + Intronic
1001803275 5:174561690-174561712 AGCACACAAGCAGCACCAGGAGG - Intergenic
1002063305 5:176639403-176639425 AGGATGCCTGTAGCGCCAGGGGG + Intronic
1002190103 5:177473473-177473495 AAGCCGCCAGCAGCTCCAGGCGG + Intronic
1002805230 6:567267-567289 AGGACGCCTGCAGCACCAGGAGG - Intronic
1002897477 6:1388120-1388142 AGGGCTCCTGCCGCCCCAGGGGG + Intergenic
1003121550 6:3322611-3322633 AGGACCTCGGCAGCAGCAGGGGG - Intronic
1004015797 6:11730822-11730844 GGGACACCTGCAGCATCAGTAGG + Intronic
1004426988 6:15513429-15513451 AGGGCGCCGGCAGGGCCAGGCGG - Intronic
1008542609 6:52558268-52558290 AGGAGCCCGGGAGCACCAGGTGG + Intronic
1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG + Intronic
1016383656 6:143511305-143511327 AGGGTGCAGGCAGCACCAGGCGG + Intronic
1018126858 6:160690697-160690719 AGGGCCCCTGCAGCCTCAGGAGG - Intergenic
1018149692 6:160926395-160926417 AGGGCCCCTGCAGCCTCAGGAGG + Intergenic
1019994912 7:4717680-4717702 AGGAGGCCACCAGGACCAGGCGG - Intronic
1022807979 7:33842348-33842370 AGGAGGACTGCAGCCCCAGCTGG - Intergenic
1023638736 7:42237725-42237747 AGGACGCCTGCCGCCGCAGGGGG + Intronic
1023830266 7:44035066-44035088 AGGAAGCCTGCAGCTGGAGGGGG - Intergenic
1027961013 7:84945245-84945267 AGGACTCCTGAAGGACAAGGTGG - Intergenic
1028753999 7:94413924-94413946 TGGAAGCCTGGAGGACCAGGGGG - Exonic
1029605025 7:101593465-101593487 AGGACACCTGGAGAACCTGGAGG + Intergenic
1032433179 7:131879681-131879703 AGGATGCCTCTGGCACCAGGGGG + Intergenic
1035058019 7:156049840-156049862 AGGAAGCCTTCAGCAGGAGGCGG + Intergenic
1039211125 8:35215596-35215618 CGGACGCCTGTAGTCCCAGGAGG + Intergenic
1041601202 8:59719025-59719047 AGGAAGCCTGCCACATCAGGAGG + Intergenic
1045443813 8:102239626-102239648 AGGACACCTGCCGCACCAAGTGG - Intergenic
1046991276 8:120458299-120458321 AAGACAACTGCAGCACCAAGAGG - Intronic
1049090443 8:140510540-140510562 AGGAGGCCGGCAGTACCAAGGGG - Intergenic
1049224159 8:141441691-141441713 AGGATCCCTGCAGCTCCAGGTGG + Intergenic
1049241404 8:141539206-141539228 AGGCCCCCTGGAGCACCACGTGG - Intergenic
1054909086 9:70437673-70437695 AGGACGGCTTGAGCCCCAGGAGG - Intergenic
1057804131 9:98208711-98208733 AGAAGGCCAGCAGCACCCGGCGG + Exonic
1058885973 9:109321125-109321147 AGCACACCTACAGCAGCAGGGGG - Intergenic
1060191686 9:121598143-121598165 AGGACGCCTGTAATTCCAGGGGG - Intronic
1060876747 9:127089406-127089428 ATGACGCCTGCCGCACAGGGCGG + Intronic
1186894379 X:13991367-13991389 AGGATGACTGCAGCAGCAGATGG + Intergenic
1191115059 X:56843768-56843790 AGGACACCTGCAGCACCTTCAGG + Intergenic
1197457719 X:126698754-126698776 AGGGCGCCTGTAGTCCCAGGAGG + Intergenic
1199699165 X:150363681-150363703 TGGCCGCCCGCAGCGCCAGGTGG - Intronic