ID: 1002813028

View in Genome Browser
Species Human (GRCh38)
Location 6:652287-652309
Sequence TACTAAGATGTGTTTCCGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002813028_1002813033 5 Left 1002813028 6:652287-652309 CCCAACGGAAACACATCTTAGTA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1002813033 6:652315-652337 GAGGGTTCAAGCGACTCGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 364
1002813028_1002813034 6 Left 1002813028 6:652287-652309 CCCAACGGAAACACATCTTAGTA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1002813034 6:652316-652338 AGGGTTCAAGCGACTCGCCTGGG 0: 1
1: 0
2: 2
3: 25
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002813028 Original CRISPR TACTAAGATGTGTTTCCGTT GGG (reversed) Intronic
902297424 1:15477340-15477362 TACTAAGACGTGTTAACGGTGGG + Intronic
902586293 1:17440416-17440438 TACTGATCTGTCTTTCCGTTAGG - Intergenic
903067739 1:20710223-20710245 TACAAAGGTGGGTTTCCTTTAGG + Intronic
904818673 1:33225632-33225654 TACTGAGATGTGTTTAAGTATGG + Intergenic
911496289 1:98635689-98635711 TACTCAGATGTGTAGCCCTTTGG - Intergenic
912008711 1:104933653-104933675 GACTAAGGTGTGTTTCGGTGGGG - Intergenic
913575140 1:120164745-120164767 TAGAAAGATTTGTTTCCTTTTGG + Intronic
914557443 1:148780385-148780407 TAGAAAGATTTGTTTCCTTTTGG + Intergenic
914615391 1:149349845-149349867 TAGAAAGATTTGTTTCCTTTTGG - Intergenic
918825198 1:189315093-189315115 TATTAAGATGAGTTTCCATTAGG - Intergenic
919995202 1:202741569-202741591 TGCTGAGATGCGTATCCGTTTGG - Exonic
920988488 1:210913131-210913153 TACTACTATGCGTTTCAGTTGGG - Intronic
923628679 1:235635235-235635257 TATTAAAATGTGATTCCTTTGGG + Intronic
1063574613 10:7250571-7250593 TAGAATGATGTGTTTCCCTTTGG + Intronic
1064057294 10:12108100-12108122 TACTAAGCTGTGTTACAGTTAGG - Intronic
1065505281 10:26424365-26424387 AACCAAGATGTATTTCTGTTAGG + Intergenic
1065750074 10:28877859-28877881 TACTAAAATGTGATTCCCTAAGG - Intronic
1070204794 10:74246867-74246889 CACTAAGATGTTTTTTAGTTTGG + Intronic
1073448321 10:103594009-103594031 AATTAAGAGGTGATTCCGTTCGG + Exonic
1078639398 11:13081169-13081191 TACTAACATGTGTGTGCGTTGGG + Intergenic
1080197032 11:29623410-29623432 TACTAAGGTGGGTTTCAGTTTGG - Intergenic
1086956725 11:92941456-92941478 CACTAAGATTTCTTTCCATTTGG + Intergenic
1091874977 12:3926084-3926106 TAATGAGATGTCTTTCTGTTAGG + Intergenic
1093478538 12:19581670-19581692 TAATAAGAAGTGTTACCTTTGGG + Intronic
1093738572 12:22654028-22654050 TATTAAGAGGTGTGTCCCTTTGG + Intronic
1094235263 12:28157161-28157183 TACTAATGTGTGTTTGCTTTGGG + Intronic
1097092820 12:56521028-56521050 TCCTTAGATGTGTTTCTCTTGGG - Intergenic
1098604626 12:72374898-72374920 TTCTCAGATGTGTTTTGGTTTGG + Intronic
1100814359 12:98371711-98371733 TCCTAAAATGTGTTTCCCTGAGG - Intergenic
1107880132 13:44825483-44825505 TTCTAAGATGTGTTCGTGTTTGG - Intergenic
1114888817 14:26889950-26889972 TTCTAACATTTGTTTCTGTTTGG + Intergenic
1115161066 14:30394796-30394818 TTTTAAGATGTTTTTCCTTTTGG + Intergenic
1118695435 14:68380331-68380353 TAATCAGGTGTGTTTCAGTTTGG - Intronic
1121445703 14:93977581-93977603 TACTGAGATGTATTTCCTTGTGG - Intergenic
1149484333 17:57030232-57030254 TACTAAGATATTTTTCACTTGGG - Intergenic
1152029562 17:77833584-77833606 TATTAAGAGGTGTGTCCTTTGGG - Intergenic
1154942395 18:21127738-21127760 TACTAAGATCTTTTTTCCTTAGG + Intergenic
1160300473 18:77673508-77673530 TACTTAGAAATGTTTCCATTAGG + Intergenic
1164774742 19:30844164-30844186 TCCTAAAATGTGTTTTCTTTTGG + Intergenic
925594605 2:5543034-5543056 TACTTGGATGTGGTTCCTTTGGG + Intergenic
926529811 2:14030463-14030485 TATCAAAATGTGTTTCAGTTGGG + Intergenic
928654855 2:33439948-33439970 TTCTCAGATGTGTCTCCATTGGG - Intronic
929035086 2:37683086-37683108 TACTAAGGTGTGTTTGCTTCTGG - Intronic
931630712 2:64296084-64296106 TACTAAATTGTTTTTCTGTTAGG - Intergenic
932186416 2:69700146-69700168 TTACAAGATGTGTTTCCATTTGG - Intronic
932464631 2:71909533-71909555 TACTAAGATGTGATTCTTTTAGG - Intergenic
939028114 2:137038583-137038605 TTCTAAGTTGTGTTTCTGTGGGG + Intronic
939552144 2:143628309-143628331 TAGAAAGATTTGTTTCCTTTTGG + Intronic
943397151 2:187353578-187353600 TTCATAGATGTGTTTCCATTAGG - Intronic
944622961 2:201537610-201537632 TACTAAGTAGTGTTTATGTTTGG - Intronic
944649505 2:201815208-201815230 TATTAAGATATATTTCCCTTGGG - Intronic
945237385 2:207643969-207643991 TACTATAATGTGTTTCAGTGTGG - Intergenic
1169941652 20:10944361-10944383 TTCTAAGATGTTTTTTCTTTTGG + Intergenic
1178503599 21:33145527-33145549 TGCTAAGAGGTGTCTCAGTTTGG + Intergenic
1181675066 22:24445947-24445969 TCCAAGGAAGTGTTTCCGTTTGG + Intergenic
1183147629 22:36009321-36009343 TACTTAGCTGTGTGTCCTTTAGG - Intronic
949629535 3:5908496-5908518 TAGAATGATTTGTTTCCGTTTGG + Intergenic
956401646 3:68885961-68885983 TCTTAAGATGTGTTTGCTTTAGG - Intronic
962289245 3:134117995-134118017 TACTATGATTTCTTTCCCTTTGG + Intronic
963473385 3:145773044-145773066 TAAAAAGATGTGGTTCCTTTTGG - Intergenic
965053216 3:163679036-163679058 TACTAAGAGGTCCTTCCATTAGG + Intergenic
966502323 3:180657247-180657269 TGCTAAGAGGTGGTTCCGTTAGG - Intronic
974366675 4:60959004-60959026 TAATAAGATGTGTCTCTCTTTGG + Intergenic
974672471 4:65050048-65050070 TAATAAGATCTGTTTCAGATGGG - Intergenic
980062305 4:128144287-128144309 TACTATGATGTGTCTTGGTTTGG + Intronic
981002750 4:139843322-139843344 TACTAAGATGTGTCTACTCTCGG + Intronic
983424446 4:167565105-167565127 AATTAAGATATGTTTCCTTTTGG + Intergenic
987293755 5:16532114-16532136 TACTAAGATGTGATGTCATTGGG - Intronic
989532318 5:42522672-42522694 TTCTAAGATTTGTTTCCCTTGGG + Intronic
989766544 5:45091637-45091659 TATTAAGACGTGTGTCTGTTTGG - Intergenic
992869267 5:80990180-80990202 TAGTAAGAGGTCTTTCCTTTAGG - Intronic
995999265 5:118339337-118339359 AACAAAGATCTGTTTCCTTTAGG + Intergenic
996408423 5:123129818-123129840 TATTAAGATGTGTTCCACTTAGG + Intronic
1002813028 6:652287-652309 TACTAAGATGTGTTTCCGTTGGG - Intronic
1002899620 6:1399994-1400016 TGGTAAAATGTATTTCCGTTCGG - Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1010051396 6:71508495-71508517 TAATAAGATGTATTTCAGTAGGG + Intergenic
1010065084 6:71673209-71673231 TCCTAACATATGTTTCCTTTGGG + Intergenic
1012046047 6:94274769-94274791 TACAAACATGTTTTTCCATTAGG + Intergenic
1012371812 6:98516390-98516412 TACTATGATATGGTTCCTTTAGG + Intergenic
1015351256 6:132222816-132222838 TACTAACATCTGTTTTTGTTTGG + Intergenic
1016137427 6:140561862-140561884 TACTAACATGTGATTCTCTTCGG - Intergenic
1022702825 7:32777423-32777445 GACTTAGATGTGTTTCCAATGGG - Intergenic
1026075967 7:67168535-67168557 TATTAAGTTGTGTTTTCTTTAGG + Intronic
1030786956 7:113674280-113674302 TACTAAGATGTGGGGCCTTTAGG + Intergenic
1031010539 7:116522195-116522217 GACTAAGATGTGTTTCTCTTTGG + Intergenic
1032680931 7:134182507-134182529 TACTTATATGTGTTTCCCATAGG + Intronic
1036424424 8:8630503-8630525 TATTAAGGTGTGGTTCCTTTAGG + Intergenic
1038973521 8:32665158-32665180 TACTAAGATTTATTTCTGTATGG + Intronic
1040370835 8:46771815-46771837 GACTAAGATTTGTTTTCTTTGGG + Intergenic
1041605917 8:59782175-59782197 TATTAAGATGTGTCTCCATTAGG - Intergenic
1044177567 8:89147783-89147805 AACAAAGATGTGTTTTCCTTTGG + Intergenic
1046414344 8:113892203-113892225 TACTAAGATGTGAAGCCTTTGGG + Intergenic
1047321362 8:123787034-123787056 CACTATGCTGTGTTTCCCTTTGG - Intronic
1052035235 9:23673091-23673113 TATTAATATGTGATTCTGTTGGG - Intergenic
1052581767 9:30366096-30366118 TATAAAGATCTGTTTCCTTTGGG + Intergenic
1054929726 9:70623496-70623518 TACTAAGATGTAATTGGGTTTGG + Intronic
1056300852 9:85239327-85239349 TACTAAGAGGTGGTGCCATTAGG - Intergenic
1186208291 X:7223232-7223254 TACAATGATGTCTTTCCCTTTGG + Intronic
1186523971 X:10230659-10230681 TGCTAACATTTGTTTCCTTTAGG + Intronic
1197462348 X:126757870-126757892 TACTATGAAGTGTTTCGTTTTGG - Intergenic
1197618939 X:128725176-128725198 TAGTCAGATGTGTTTTTGTTGGG + Intergenic
1198968072 X:142249276-142249298 TAGAAAGATGTGTTTTCTTTTGG + Intergenic
1201362250 Y:13165251-13165273 TAATTAGATGTGTTTTCCTTTGG - Intergenic