ID: 1002814698

View in Genome Browser
Species Human (GRCh38)
Location 6:668940-668962
Sequence CCATATCCATGGGTTCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 10, 3: 35, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002814698_1002814703 17 Left 1002814698 6:668940-668962 CCATGCAGAACCCATGGATATGG 0: 1
1: 0
2: 10
3: 35
4: 181
Right 1002814703 6:668980-669002 TTTTTTACTTACTTGGTGCTAGG 0: 1
1: 0
2: 3
3: 33
4: 420
1002814698_1002814704 27 Left 1002814698 6:668940-668962 CCATGCAGAACCCATGGATATGG 0: 1
1: 0
2: 10
3: 35
4: 181
Right 1002814704 6:668990-669012 ACTTGGTGCTAGGCACATGAAGG 0: 1
1: 0
2: 1
3: 25
4: 166
1002814698_1002814702 10 Left 1002814698 6:668940-668962 CCATGCAGAACCCATGGATATGG 0: 1
1: 0
2: 10
3: 35
4: 181
Right 1002814702 6:668973-668995 GTATTTCTTTTTTACTTACTTGG 0: 2
1: 0
2: 2
3: 64
4: 849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002814698 Original CRISPR CCATATCCATGGGTTCTGCA TGG (reversed) Intronic
900874732 1:5333716-5333738 TCATCTCCATGTCTTCTGCAGGG + Intergenic
901462549 1:9400282-9400304 CCAGCTTCATGGGGTCTGCAGGG + Intergenic
902249470 1:15144587-15144609 CCACACCCAGGGCTTCTGCAGGG - Intergenic
904418940 1:30379200-30379222 CCAAGTCGCTGGGTTCTGCAAGG + Intergenic
905758738 1:40535337-40535359 CCATATTCATGGGTTTTGCATGG + Intronic
906235579 1:44206367-44206389 ACTTATGCACGGGTTCTGCAGGG + Intergenic
908549397 1:65193688-65193710 TCATACCCATGGGTTCCACAGGG - Intronic
913499810 1:119461886-119461908 CCCTCTTCAGGGGTTCTGCATGG + Intergenic
914241132 1:145853904-145853926 CCAGAGCCATGGGGTCAGCAAGG + Intronic
915153708 1:153856885-153856907 CCATATCCATAGTATCTGGAGGG - Intronic
918431684 1:184467434-184467456 CCATATCCAAGGGCTCTAAAGGG - Intronic
919399402 1:197092381-197092403 CCATTTCCAAGAGTTCTGCTTGG - Intronic
920040488 1:203092085-203092107 CCATTTCCTAGGTTTCTGCAGGG + Intronic
920284036 1:204866888-204866910 CCATATCCATGGTTAGTGCGTGG + Intronic
921497545 1:215859589-215859611 TCATATACATGGATTCTGCACGG + Intronic
922534518 1:226370043-226370065 TCTCCTCCATGGGTTCTGCAGGG + Intronic
922793297 1:228322601-228322623 TCATATATATAGGTTCTGCAGGG - Intronic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
924060587 1:240170151-240170173 CCATGTCCACGGGTTCTGGTCGG - Intronic
924560926 1:245156002-245156024 CCGTTTCCACGGCTTCTGCAAGG - Intronic
1065640485 10:27777413-27777435 CTGTATCCACGGGTTCCGCATGG + Intergenic
1067164224 10:43852489-43852511 CCTTACACACGGGTTCTGCAGGG - Intergenic
1067551139 10:47237452-47237474 CCATATCACTGGGTACTGCCAGG - Intergenic
1070597477 10:77842713-77842735 CCATAGACACCGGTTCTGCATGG + Intronic
1072877439 10:99188031-99188053 TCATATCCATGGTTTCTGCAAGG + Intronic
1075289923 10:121220231-121220253 TCATATACCTTGGTTCTGCAGGG - Intergenic
1075327080 10:121542442-121542464 CCAGATCCATTGGTTCTGCAGGG - Intronic
1075707391 10:124509836-124509858 CCTTATCCAGGGGCTCTGCCAGG - Intronic
1076779730 10:132717490-132717512 CCATCTGCCTGGGTTCTGCCTGG + Intronic
1080754127 11:35179170-35179192 ACATTTCCATGGGTCGTGCAGGG + Intronic
1081173672 11:39899444-39899466 CCATAGCCGCGGGTTCTACATGG - Intergenic
1085445706 11:76599347-76599369 CCACATCCCTGGGGTCTGCTGGG - Intergenic
1085951985 11:81343355-81343377 CAAAATCCCTGGGTTCTCCAAGG - Intergenic
1088135496 11:106552045-106552067 CCTCCTCCATGGCTTCTGCAGGG + Intergenic
1088295027 11:108283737-108283759 TCATATACGTGGGTTCTGCAGGG - Intronic
1088870014 11:113882779-113882801 TCCTATACGTGGGTTCTGCAGGG - Intergenic
1089004838 11:115082747-115082769 CTCTTTCCATGGGTGCTGCAGGG - Intergenic
1092196527 12:6552906-6552928 CGATATCCATGTGTTCTGCATGG + Intronic
1092223619 12:6732038-6732060 CCATATCCATTACTTCTGAATGG - Intergenic
1093442816 12:19219166-19219188 TCACATACATGGGCTCTGCAAGG + Intronic
1095041168 12:37442463-37442485 CCATATCCTTGGCATTTGCAGGG - Intergenic
1096634710 12:52950789-52950811 CGACATCCATGGGCTCCGCAAGG + Exonic
1097950237 12:65419459-65419481 CGACATCTATGGGCTCTGCAAGG - Intronic
1098875545 12:75863085-75863107 CCAGAGCCATGGTTTCTGTATGG + Intergenic
1103566930 12:121820987-121821009 GCCTATACGTGGGTTCTGCAAGG + Intronic
1109935496 13:69278109-69278131 CCATATCCATGGTTTATGCTAGG + Intergenic
1111571600 13:90094677-90094699 TCAAATCCATGGTTTCTTCATGG - Intergenic
1111581683 13:90230930-90230952 TGACATCCATGGGCTCTGCAAGG + Intergenic
1112238963 13:97662281-97662303 CCAAATCCATTTGTTCTCCATGG + Intergenic
1113100937 13:106717220-106717242 TTATATCCATGGGTTCTGCAAGG + Intergenic
1113346522 13:109483239-109483261 TCACAGCCATGCGTTCTGCAGGG + Intergenic
1114377227 14:22160184-22160206 CCATCTCCACTGATTCTGCAAGG + Intergenic
1116241411 14:42347794-42347816 CCTTTTCCATTGGTACTGCAAGG - Intergenic
1118966850 14:70595092-70595114 CAACATCCATGGGCTCTGCAAGG + Intronic
1126293614 15:47111268-47111290 CCATATCCTTGGCATTTGCAGGG + Intergenic
1128036145 15:64528528-64528550 CCCTCTCCAAGGGGTCTGCATGG + Intronic
1131921926 15:97337560-97337582 CCATATCTATAGGTTCTACAAGG - Intergenic
1132085230 15:98903023-98903045 CCATAGCCATGGTTTCCTCAAGG + Intronic
1132414916 15:101613013-101613035 CCCTCTCCATGGGATCTCCATGG + Intergenic
1132465490 16:75588-75610 CCATATCCCAGGGTTTGGCAAGG + Intronic
1134055105 16:11165080-11165102 CCATCACCATGGGTCCTGCTTGG + Intronic
1140181962 16:72729154-72729176 TGACATCCATGGGCTCTGCAAGG + Intergenic
1140926658 16:79590145-79590167 CTTTATGCATGGGTTCTGCGGGG - Intronic
1141310199 16:82906701-82906723 CCATATTCATGGTTTCGGCAGGG + Intronic
1142197632 16:88746069-88746091 CCTGATCCATGGGGTGTGCATGG + Intronic
1144718066 17:17448011-17448033 CCAAAACCAAGGTTTCTGCAGGG - Intergenic
1146791535 17:35753337-35753359 CCCTCTCCCTTGGTTCTGCAGGG - Intronic
1148322095 17:46763402-46763424 CCAGATCCTTGGGAACTGCATGG + Exonic
1149936340 17:60810705-60810727 GGACATCCATGGGCTCTGCAAGG + Intronic
1153206863 18:2712544-2712566 TCATATACACAGGTTCTGCAGGG + Intronic
1154295623 18:13144446-13144468 TCCTACCCACGGGTTCTGCAGGG - Intergenic
1155310605 18:24519094-24519116 CCTTGTCCTTGGCTTCTGCATGG - Intergenic
1156977268 18:43237998-43238020 GCATACCCATGGGTTCTACCTGG + Intergenic
1157352999 18:46907770-46907792 TCCTATACATGGGTTCTGCAGGG + Intronic
1157665152 18:49479781-49479803 CCATGTCTCTGGGTTCTGCTGGG - Intronic
1157672659 18:49543336-49543358 TCATATTTATGGGTTCTGCAGGG + Intergenic
1159918110 18:74203763-74203785 GCATAGCCTTGGGTTCTGGAAGG - Intergenic
1160554917 18:79718660-79718682 CCATTTACATGGGGTCTCCAGGG - Intronic
1161065256 19:2234355-2234377 CCATACTCATGGGTTCTGGGGGG - Intronic
1163819255 19:19486859-19486881 CCCTCTCCATGGCTCCTGCATGG - Intronic
1166295657 19:41888064-41888086 CCATCTCCCTGGGCTCTGCAGGG - Exonic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
925632070 2:5904773-5904795 CCATGTGCATGTGTTCTGCCTGG + Intergenic
925858233 2:8150906-8150928 ACTTATGCATGTGTTCTGCAGGG - Intergenic
926036095 2:9637106-9637128 CCATATCTATGGTCTATGCAAGG + Intergenic
926536770 2:14122777-14122799 TCATATCCAGAGGTTCTGAAGGG - Intergenic
928495097 2:31823334-31823356 CGACATCCATGGGCTCTGCGAGG - Intergenic
929214240 2:39393796-39393818 TCATATACACAGGTTCTGCAGGG - Intronic
929320147 2:40533231-40533253 TCATCTCCATGGTTTCTGCCAGG - Intronic
929401468 2:41586869-41586891 CCATAACCATGAGATCTGGAAGG + Intergenic
929849002 2:45564834-45564856 TCATATACATGGGTTCTGCAGGG + Intronic
931495920 2:62806980-62807002 TCCTATCTGTGGGTTCTGCAGGG - Intronic
931791394 2:65667004-65667026 CGACATCCATGGGCTCCGCAAGG + Intergenic
934918262 2:98318935-98318957 TCATATCCATGGGTTCCACAGGG - Intergenic
935633909 2:105235245-105235267 CCAGATCCATGGGAGATGCAGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936226180 2:110654939-110654961 CCATATCCACAAGTTCTGCAGGG + Intronic
937976032 2:127582566-127582588 CCAGATCCGTGTGCTCTGCATGG + Intronic
939126921 2:138188516-138188538 CCATATGCATGTCTTCTGCCTGG + Intergenic
940760431 2:157733050-157733072 TCCTATGCAAGGGTTCTGCAAGG + Intergenic
942054948 2:172173404-172173426 CCATATACTTGTGTTCTGGAAGG - Intergenic
942075942 2:172357328-172357350 CCATTTTCATGTGTTTTGCATGG + Intergenic
942624517 2:177885367-177885389 TCATATCTGTGGGTTCTGCAGGG + Intronic
943186822 2:184618528-184618550 CCATATCCATAGGTTTCACAGGG + Intronic
944873289 2:203935433-203935455 CCACAGCCAAGGGGTCTGCAAGG - Intergenic
1169618504 20:7477506-7477528 ACATATTCATGACTTCTGCATGG + Intergenic
1171140087 20:22733528-22733550 CTACCTCCATGGGCTCTGCAAGG - Intergenic
1171535760 20:25887372-25887394 CCATATCCTTGGCATTTGCAGGG - Intergenic
1171572099 20:26262526-26262548 CCATATCCTTGGCATTTGCAGGG + Intergenic
1171805333 20:29673812-29673834 CCATATCCTTGGCATTTGCAGGG + Intergenic
1171838720 20:30182618-30182640 CCATATCCTTGGCATTTGCAGGG - Intergenic
1172275651 20:33677476-33677498 CCATAACCATCTGCTCTGCAGGG + Exonic
1172664386 20:36589113-36589135 CCATAGCTAAGGGTTCTGGAAGG - Intronic
1173691466 20:44964432-44964454 TCGTTTCCATAGGTTCTGCAGGG - Intergenic
1174349582 20:49957282-49957304 CGACATCCATGGGCTCTGCAAGG + Intergenic
1174454887 20:50641958-50641980 ACACATCCAAGGGCTCTGCAGGG - Intronic
1174471915 20:50767772-50767794 ACACATCCAAGGGCTCTGCAGGG + Intergenic
1175466661 20:59194238-59194260 CCGTATCCATCGCCTCTGCATGG + Exonic
1177618180 21:23553153-23553175 GCATATGTATTGGTTCTGCATGG + Intergenic
1180887577 22:19258061-19258083 CGACATCCATGGGCTCTGCAAGG + Intronic
1181235509 22:21445798-21445820 CCAGATCCATGGGCTCATCAGGG - Exonic
1182924416 22:34109063-34109085 CAATATCCATGTGCTCTTCAGGG - Intergenic
1183339843 22:37274083-37274105 CAATGTCCATGGGGTCAGCAAGG - Intergenic
950494202 3:13324067-13324089 CCACATCCCTGGGAGCTGCAGGG - Intronic
951095478 3:18624876-18624898 CCACATCCATGGGGCTTGCAAGG - Intergenic
951725263 3:25750890-25750912 TTATATACATGGGTTCTGCAGGG - Intronic
952264231 3:31769934-31769956 CCATCTCAATGGGTTTTTCAAGG + Intronic
952933473 3:38377298-38377320 CAAGATCCATGGGTTCTTGATGG - Intronic
953169969 3:40498064-40498086 CCAGATCCCTGGGTGCTGCTTGG + Intergenic
953805177 3:46062227-46062249 GCATGTCCATGGCTGCTGCAGGG - Intergenic
954383664 3:50233120-50233142 CCATCTCCATGGGGTCCCCAGGG - Intronic
954454685 3:50591317-50591339 GCAAGTCCATGAGTTCTGCAAGG - Intergenic
955425851 3:58788912-58788934 TCATATATGTGGGTTCTGCATGG - Intronic
955631593 3:60981076-60981098 TCATAGCCAAGGGCTCTGCAAGG + Intronic
955691330 3:61593195-61593217 CCATATCCATCTCTTCTTCATGG + Intronic
955989996 3:64616334-64616356 ACATATCCATGTGTTTTTCATGG + Intronic
956275715 3:67498971-67498993 TCACATACATGGGTTCTGCAAGG + Intronic
956677318 3:71748287-71748309 TCATATATATGGGTTCTGCAGGG + Intronic
963991328 3:151658927-151658949 TCTTAACAATGGGTTCTGCATGG + Intergenic
963997930 3:151732767-151732789 CCCTTTCCATTGGCTCTGCAAGG - Intergenic
965544711 3:169903696-169903718 CAACATCCGTGGGCTCTGCAAGG - Intergenic
966614566 3:181899434-181899456 ACATGTCCATGGGTTTTCCAAGG - Intergenic
967594881 3:191317089-191317111 CCACCCCCATGGGCTCTGCACGG - Intronic
970162104 4:13199284-13199306 TCATACCCATGGGTTCTGCAGGG - Intergenic
970720431 4:18982087-18982109 CTGTATCCATGGTTTCTGCATGG - Intergenic
971922825 4:32965423-32965445 ACATATCCATGGATTCTTTATGG + Intergenic
971991930 4:33909394-33909416 CCATATCAATGGGTTAAGCAAGG + Intergenic
975464353 4:74692723-74692745 TCATATCTGTGGGTTCTGCATGG - Intergenic
976211220 4:82672368-82672390 TAATATCCATGGGATCTGTAGGG - Intronic
980417979 4:132518432-132518454 TCCTATCCCTGAGTTCTGCAGGG - Intergenic
982005957 4:151063053-151063075 CCATATCCACGGGTTCCACATGG + Intergenic
982071533 4:151699527-151699549 CTTTATTCATGGGTCCTGCATGG - Intronic
982934059 4:161448692-161448714 CCATAGCCATTGGCTATGCAGGG + Intronic
983961760 4:173762698-173762720 CCATACCCATGGGATCTGTGTGG - Intergenic
984342501 4:178475332-178475354 CCATGTAGATGGGTTCTGCAGGG + Intergenic
989012213 5:36885742-36885764 CGACATCCGTGGGCTCTGCAAGG + Intronic
991954560 5:71980014-71980036 TCCTATACGTGGGTTCTGCAGGG + Intergenic
992263879 5:74998047-74998069 TCATATATGTGGGTTCTGCAGGG - Intergenic
992607072 5:78468985-78469007 TTGTATACATGGGTTCTGCAGGG - Intronic
992868268 5:80980146-80980168 CCTTATCCATGAGTGCTGAATGG - Intronic
994067486 5:95559366-95559388 TCCTATCCATGGGTTCCACAGGG + Intronic
994109618 5:95986529-95986551 CCATATCCATATGTACTCCAAGG - Intergenic
994346870 5:98697588-98697610 CCATTTCCATGGCTTCTGACAGG - Intergenic
997715861 5:136042162-136042184 GCATATGCATGGGATATGCATGG - Intronic
997916070 5:137926844-137926866 CCCTATATGTGGGTTCTGCAGGG + Intronic
1001032182 5:168271073-168271095 ACATTCCCATGGGTGCTGCAAGG - Intergenic
1002538109 5:179889358-179889380 ACATATCCATGGGGTGTGCCTGG + Intronic
1002814698 6:668940-668962 CCATATCCATGGGTTCTGCATGG - Intronic
1003997127 6:11553155-11553177 TCACATACATGGGTTCTGCAGGG - Intronic
1005424236 6:25684405-25684427 CCCTATCTGTGGGTTCTTCAGGG - Intronic
1005761219 6:28969861-28969883 CGACATCCATGGGTTCCGCAAGG - Intergenic
1008766709 6:54925746-54925768 CCATATACGTGGGTTCTTCAGGG + Intronic
1014112210 6:117631191-117631213 CCATTTCCATGGCTTAAGCAGGG - Intergenic
1015373531 6:132483378-132483400 CCTTTTCCATGGATTCTGCATGG - Intronic
1016652251 6:146475861-146475883 CTATATCCATGGGATAAGCATGG + Intergenic
1016906588 6:149156893-149156915 CCATATTCATGGGCACTGCCTGG - Intergenic
1016906600 6:149156974-149156996 CCATATTCATGGGCACTGCCTGG - Intergenic
1018602135 6:165555791-165555813 CCATCTCTGTGGGTTCTGCCTGG - Intronic
1019083937 6:169456722-169456744 CTCTGCCCATGGGTTCTGCATGG - Intergenic
1020393356 7:7684564-7684586 CCGTATCCATGAGTTCCTCATGG - Intronic
1020444332 7:8253717-8253739 ATACATACATGGGTTCTGCAGGG + Intronic
1021223437 7:18000655-18000677 CCATATCCATTTATTCTTCATGG + Intergenic
1022532448 7:31075533-31075555 CCATAAATATGGGTTCTCCAGGG + Intronic
1022632319 7:32096967-32096989 CCATCACCATTGGTTCTCCAGGG - Intronic
1025282967 7:57641629-57641651 CCCTGTCCTTGGGGTCTGCAGGG + Intergenic
1025287225 7:57674073-57674095 CCATATCCTTGGCATTTGCAGGG - Intergenic
1025981073 7:66406861-66406883 CCATGCCCACGGGGTCTGCAGGG - Intronic
1026073025 7:67139568-67139590 TCATATCTGTGGGTTCTGCAGGG - Intronic
1026703860 7:72672648-72672670 TCATATCTGTGGGTTCTGCAGGG + Intronic
1027205932 7:76099016-76099038 CCATGCCCACGGGGTCTGCAGGG - Intergenic
1028898034 7:96063944-96063966 CGACATCCATGGGTCCTTCAAGG - Intronic
1031009392 7:116509763-116509785 TCACCTCCTTGGGTTCTGCAGGG + Intergenic
1036069905 8:5429846-5429868 TCATATCCATTGATTCTGCAGGG - Intergenic
1038076574 8:24082199-24082221 CCTTACCTATGGGCTCTGCAGGG - Intergenic
1038416188 8:27397647-27397669 CCACCACCATGGGCTCTGCAGGG - Exonic
1039407622 8:37326713-37326735 CCATACCAAGGGGATCTGCAGGG - Intergenic
1039866768 8:41511776-41511798 CAACATCCATGGGCTCTGCAAGG + Intergenic
1040555502 8:48474387-48474409 CCATTTCCCAGGGTTCTCCATGG + Intergenic
1041460722 8:58108710-58108732 CCATATTCATGGGTTATGACTGG + Intronic
1041521809 8:58765098-58765120 CCAAATCTAACGGTTCTGCAAGG + Intergenic
1044953088 8:97452466-97452488 CCATTTCCATGTGGTCAGCATGG - Intergenic
1046357507 8:113107509-113107531 TCATTTCCATGGGTTCTGCAGGG - Intronic
1048179413 8:132181425-132181447 ACATATTCATGGGGTTTGCAGGG + Intronic
1048914852 8:139172772-139172794 ATACATACATGGGTTCTGCAGGG - Intergenic
1049050000 8:140187234-140187256 TCATATACACAGGTTCTGCAAGG + Intronic
1049052385 8:140208909-140208931 TCATATGCAGGGGTTCTGCAGGG + Intronic
1051281701 9:15447892-15447914 CCTTATCCAGGGGGTATGCAGGG - Intronic
1052613002 9:30800191-30800213 CGACATCCATGGGCTCTGCAAGG - Intergenic
1058489140 9:105477204-105477226 TCATATCATTGGGTTATGCAAGG + Intronic
1059124872 9:111674866-111674888 TCATATACACAGGTTCTGCAGGG - Intergenic
1059956036 9:119516790-119516812 CCATGCCCAGAGGTTCTGCATGG - Intronic
1061631240 9:131873619-131873641 CCATTTGCATGGGCTCTGAAGGG + Intronic
1061937032 9:133863662-133863684 CCCCTTCCATGGGTTCAGCATGG + Intronic
1062577281 9:137214618-137214640 CCATGTCCAGCGGTTCTGCCAGG + Exonic
1187931924 X:24301553-24301575 TCATATACTTGGGTTCTGCAGGG - Intergenic
1189922290 X:45914421-45914443 TCATATACGTGGGTTCTGTAGGG + Intergenic
1190838731 X:54126448-54126470 TCATATACACAGGTTCTGCAGGG + Intronic
1193155690 X:78171085-78171107 CCAAGTCCCTGTGTTCTGCAGGG - Intergenic
1194321983 X:92460203-92460225 CGACATCCATGGGCTCCGCAAGG + Intronic
1196674560 X:118405673-118405695 CCATATCCATGGGTTCCACATGG + Intronic
1197673515 X:129304601-129304623 CCATTTCCATGTGGTCTGCTTGG + Intergenic
1197731684 X:129816019-129816041 TCTTATCCGTGGGTTCTGCAGGG - Intronic
1197731712 X:129816268-129816290 TCATATCCATGGGTTCCACAGGG + Intronic
1200085881 X:153604788-153604810 CAACATCCATGGGCTTTGCAAGG - Intergenic
1200630150 Y:5573680-5573702 CGACATCCATGGGCTCCGCAAGG + Intronic
1201256099 Y:12109658-12109680 CCATCTCCATTGCTGCTGCATGG + Intergenic
1201888363 Y:18913020-18913042 CAATTTACATGTGTTCTGCAGGG + Intergenic