ID: 1002815024

View in Genome Browser
Species Human (GRCh38)
Location 6:671560-671582
Sequence AGGGAGAAGCAAAATGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 6, 2: 41, 3: 164, 4: 512}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002815024_1002815027 20 Left 1002815024 6:671560-671582 CCTATATCATTTTGCTTCTCCCT 0: 1
1: 6
2: 41
3: 164
4: 512
Right 1002815027 6:671603-671625 TTAACTTCTTTTAATAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002815024 Original CRISPR AGGGAGAAGCAAAATGATAT AGG (reversed) Intronic
900728347 1:4233763-4233785 CTGGAAAAGCAAAATGAAATTGG - Intergenic
901375254 1:8833591-8833613 AGAGAGATGAAAAATGACATTGG + Intergenic
903309877 1:22446793-22446815 AGAGAGGAGGAAAATTATATAGG + Intergenic
905021362 1:34815960-34815982 AGAAAGAAGTAAAATGATACAGG + Intronic
905287918 1:36896139-36896161 AGAGAGAAGGAAAATAATATAGG + Intronic
905288070 1:36898404-36898426 AGAGAGAAGGAAAATAATACAGG + Intronic
905964846 1:42083356-42083378 AGAGAGAAGAAAAATAATATAGG - Intergenic
908005867 1:59728522-59728544 AGAGAGAAGGAAAATGATATAGG - Intronic
908030941 1:59998824-59998846 CGAGAGAAGAAAAAAGATATAGG + Intronic
908083643 1:60607591-60607613 AGGTAGGAGCAACATCATATAGG - Intergenic
908616330 1:65927127-65927149 ATTAAGAAGAAAAATGATATAGG + Intronic
908699691 1:66885310-66885332 AGGCAAAAGAAAAATGACATGGG - Intronic
908744537 1:67362805-67362827 AGAGAGAAGGAAAATGAGATAGG + Intronic
908793451 1:67806153-67806175 AGAGTGAGGGAAAATGATATAGG + Intronic
909031886 1:70551150-70551172 AGAAAGAAGGAAAATGATATAGG + Intergenic
909313956 1:74191305-74191327 TGAGAGAAGAGAAATGATATAGG + Intronic
909589769 1:77334077-77334099 AGGTAGAAGAAAAATGATCCAGG - Intronic
910121084 1:83791274-83791296 GGGGATAAACAAAATGAAATAGG + Intergenic
910865156 1:91781744-91781766 AGAGATCAGCAAAGTGATATGGG - Intronic
910937639 1:92498314-92498336 AGGAAGAAATGAAATGATATTGG - Intergenic
912219841 1:107660800-107660822 AGGGAAAAGGAAAATTATACAGG + Intronic
912479071 1:109964399-109964421 AGAGACAAGGAAAATGATATAGG + Intergenic
913463092 1:119110260-119110282 AGAGAAAAGGAAATTGATATAGG - Intronic
914851279 1:151316168-151316190 AGGGAGGAGGAAGATGAGATGGG - Exonic
915335072 1:155136239-155136261 AGGGAGAAGCAGAGTGCTAGAGG - Intronic
915806305 1:158857006-158857028 AGGCAGAAGGAACATGATATCGG - Intergenic
916345090 1:163779563-163779585 AGGCAGAAGGAAAATAATACAGG + Intergenic
916355104 1:163897190-163897212 ATGGAGAAGCAAACTGATCTAGG + Intergenic
916519712 1:165552618-165552640 AGGCAGAAGCAACAGGATTTGGG + Intronic
916603728 1:166320273-166320295 ACAGAGAAGAAAAATGATAGAGG - Intergenic
916800632 1:168212826-168212848 AGAGAAAAGAAAAATGATATAGG + Intergenic
916913964 1:169385520-169385542 AGCGAGAAACAAAATGCTAAGGG - Intronic
916919444 1:169448310-169448332 AGGGAGAAGGAAAATGACATAGG - Intronic
917568829 1:176242013-176242035 AGGAAGAAGAAAAATGGTATAGG - Intergenic
918782004 1:188711448-188711470 AGAGAGAAAGAAAATGATATAGG + Intergenic
918950941 1:191136444-191136466 AGTGAGAAGTAAAATAATATAGG + Intergenic
919090434 1:192972067-192972089 AAGAAGAAGGAAAATGCTATGGG + Intergenic
919272440 1:195365498-195365520 AAAGAGAAGGAAAATAATATAGG + Intergenic
919364127 1:196635380-196635402 AGGCAGAAGGAAGATGATCTAGG + Intergenic
919596072 1:199563720-199563742 AGGCAGAAGAAAAATGATATAGG + Intergenic
919744963 1:201003058-201003080 AGGTAACAGCAAAATGAGATGGG - Intronic
920510475 1:206547890-206547912 AGGCAGAAAGAAAATGATATCGG - Intronic
920579148 1:207088671-207088693 AGTCACAAGCAAGATGATATGGG + Intronic
921769474 1:219018586-219018608 AGCGAGAAGGAAAATCTTATAGG + Intergenic
922111908 1:222567065-222567087 ATGGATAAGCAAAATGTTGTAGG + Intronic
924211992 1:241778997-241779019 AGAAAAAAGAAAAATGATATAGG - Intronic
924313426 1:242771166-242771188 AGGGAGAAGGAATATTAGATAGG - Intergenic
924690893 1:246349101-246349123 AGAGAGAAGGAAAATTATAAAGG + Intronic
1062944367 10:1449355-1449377 AGGGGGCAGCTGAATGATATAGG - Intronic
1063281395 10:4633228-4633250 AGGGAGACCCAAAAATATATGGG + Intergenic
1064940483 10:20729433-20729455 AGGCAGAAGGAAAATGATACTGG + Intergenic
1065383375 10:25111687-25111709 AGAGAGAAGCAGGATGAGATGGG - Intergenic
1065603124 10:27389985-27390007 GGAGAGGAGGAAAATGATATAGG - Intergenic
1065664210 10:28040678-28040700 AGTAAGAAGAAAAATGAGATTGG - Intergenic
1065681353 10:28236564-28236586 ACGGAGAAAAAAAATGAGATCGG + Intronic
1066041830 10:31556228-31556250 AGAGAGAAGGAAAATAATATAGG + Intergenic
1066511308 10:36099768-36099790 AAGGAGAAGGAAAATGATATAGG + Intergenic
1067196617 10:44125411-44125433 AGGTGGAAGGAAAATTATATAGG + Intergenic
1067983837 10:51118867-51118889 AGGGAAAAGCAACAGCATATTGG + Intronic
1068645929 10:59467801-59467823 AGAGAAAAGCAAAGTGATATAGG + Intergenic
1068890137 10:62140196-62140218 AGAGAGAAGAAAAATGATACAGG - Intergenic
1069023171 10:63512263-63512285 AGAGAGAAGGAAAATAATATAGG - Intergenic
1069369404 10:67730682-67730704 AGGGAGAAAGAAAAAGATAAAGG + Intergenic
1069719937 10:70543456-70543478 AGGGAGAAGCTTCATGACATTGG - Intronic
1070095473 10:73333763-73333785 AGAGAGAAGGAAAATGACATGGG + Intronic
1070763510 10:79042237-79042259 AGAGAGAAGGAAAATGATACAGG + Intergenic
1071017187 10:81011568-81011590 TGTTATAAGCAAAATGATATAGG + Intergenic
1071035755 10:81242765-81242787 GGAGAGAAGAAAAATGATACAGG + Intergenic
1071154162 10:82670454-82670476 TGGGTGTAGAAAAATGATATAGG - Intronic
1071222856 10:83490004-83490026 AGGGAAAAACAAAATGATAAAGG + Intergenic
1071278835 10:84081181-84081203 AGGCAGAAGGAAAATGATACAGG - Intergenic
1071295880 10:84219303-84219325 AGGGAGAGGGAAAATGGTCTAGG - Intronic
1071403939 10:85309991-85310013 AGAGGGAAGGAAAATGATACAGG - Intergenic
1071403951 10:85310212-85310234 AGAGAGAAGGAAAATGATATAGG + Intergenic
1071428737 10:85585871-85585893 AGAAAGAAAGAAAATGATATAGG + Intergenic
1072363682 10:94686791-94686813 AGGTAGAATCAAAATGATAAAGG + Intronic
1072457051 10:95585674-95585696 AGGGAAAAGAAAAATAAAATAGG + Intergenic
1072900756 10:99404528-99404550 AGTGAGATGCAAAAGGATTTGGG - Intronic
1072942371 10:99778003-99778025 AGAGAGAAGGAAAATGATATAGG - Intergenic
1073254650 10:102142953-102142975 AGGGAGAAGTGAGATGATTTGGG + Intronic
1073710777 10:106037297-106037319 AGAGGGAAGAAAAATCATATAGG - Intergenic
1073782519 10:106854995-106855017 AGAGAGAAGGAAAATGATACAGG - Intronic
1073894129 10:108134524-108134546 AGAGTTAAGAAAAATGATATAGG + Intergenic
1073929047 10:108553259-108553281 AGAGTGAAGGAAAATGATATAGG + Intergenic
1074393366 10:113076477-113076499 TGGGAGAAGAAAGATGATTTTGG - Intronic
1074671030 10:115791210-115791232 AGGGGGAAGCACAATTTTATAGG - Intronic
1075283434 10:121161533-121161555 AGGGAGAGGGAAGATCATATAGG - Intergenic
1075316517 10:121457816-121457838 AAGGGGAAGCAAAAAGAAATAGG + Intergenic
1075986531 10:126790692-126790714 AGGCAGAAGAAAAACGATATAGG + Intergenic
1076689469 10:132214523-132214545 AGGGGAAAGGAAAATGATTTAGG + Intronic
1077743741 11:4877391-4877413 AGGGAGAAGCAGGTAGATATTGG - Intronic
1078591526 11:12644616-12644638 AGAGAGAAGGGAAATGATATAGG + Intergenic
1078779813 11:14426853-14426875 AGAGAGGAGCAAAATGACATGGG + Intergenic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1078971286 11:16414660-16414682 AGAGAGAGACAAAATGCTATGGG + Intronic
1080166765 11:29246511-29246533 AGGGAGAAGGAAAAATACATAGG + Intergenic
1081101714 11:39010335-39010357 ATGGAGAAGCCAAAGGAAATAGG - Intergenic
1081555705 11:44158721-44158743 AGAGAGAAGGAAAATGATATAGG - Intronic
1081704051 11:45170391-45170413 AGGGAGTTGCAATATTATATAGG + Intronic
1082143564 11:48638625-48638647 AGGGAGAAGAAAAGAGATGTTGG - Intergenic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1085259240 11:75194806-75194828 AGGGAGAAGAAAAGAGAGATGGG - Intronic
1086000810 11:81984150-81984172 AGGAACAAGAAAAATAATATAGG - Intergenic
1086270398 11:85056958-85056980 AGGTAGAAGGAAAATGATACTGG + Intronic
1086363608 11:86085784-86085806 CAAGAGAAGGAAAATGATATAGG - Intergenic
1086788221 11:90999741-90999763 AGGCAGAAGGAAAATTACATAGG + Intergenic
1087054876 11:93924178-93924200 AGAGGGAAGGAAAACGATATGGG + Intergenic
1087609911 11:100422020-100422042 AGAGAGAAGGAAAATGATATAGG + Intergenic
1088136454 11:106561647-106561669 GGGGTGAAGGAAAATGTTATTGG + Intergenic
1088287004 11:108199878-108199900 AGAGAGAAAGAAAATGCTATAGG - Intronic
1089473224 11:118737592-118737614 AGAGAGAAGGAAAATAATATAGG - Intergenic
1089503591 11:118947973-118947995 AGTGAGAAACAAAATGATCCAGG - Intronic
1089707775 11:120292874-120292896 AGGGAGAAGAAAACTTTTATGGG + Intronic
1089800452 11:121023091-121023113 AGGGGGAAACAAAATTATTTAGG - Intergenic
1089902637 11:122003814-122003836 AGAGAGAAAGAAAATGATAGAGG + Intergenic
1090829956 11:130414473-130414495 AAGGAGAAACAAAAGGAAATGGG - Intronic
1090834362 11:130443332-130443354 AGGGACAAGCACTATGATCTGGG - Intergenic
1091208904 11:133840308-133840330 AAAGAGAAGGAAAAGGATATAGG + Intergenic
1091462212 12:652530-652552 AGAAAGAAGGAAAATGAAATAGG + Intronic
1091555265 12:1568421-1568443 AGAGAGAAAGAAAATGCTATAGG + Intronic
1092673087 12:10885388-10885410 AGGGAGAAAAAAAAAGATATAGG - Intronic
1093105662 12:15083425-15083447 AGAAAGAAGAAAAATGATACAGG + Intergenic
1093319082 12:17690346-17690368 AGGCTGAAGGAAAATGACATAGG - Intergenic
1093473561 12:19530992-19531014 AGAGAGAAGGATAATGATACAGG - Intronic
1093541547 12:20293030-20293052 AGAGAGAAGGAAAATCATATAGG - Intergenic
1093553758 12:20446812-20446834 AGGGAGACACAAACTGATAAAGG + Intronic
1093592082 12:20914642-20914664 TGTTAGAAGGAAAATGATATAGG - Intronic
1094274775 12:28660201-28660223 AGAGAGAAGGAAAATGATATAGG + Intergenic
1094363224 12:29652323-29652345 AGGAAGACCCAAGATGATATTGG + Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095600807 12:44011007-44011029 AGAGACAAGGGAAATGATATAGG - Intronic
1095608948 12:44104605-44104627 AGAGAGAAGAAAAAGTATATAGG - Intronic
1096073132 12:48787183-48787205 AGGCTGAAGCAAAATGTTGTGGG - Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096727715 12:53578484-53578506 AGAGAGAAGGAAAATGAGCTAGG + Intronic
1097337141 12:58395770-58395792 AGGGACAAGCATAAGGCTATAGG - Intergenic
1097390995 12:59012560-59012582 AGAAAGAATCAATATGATATGGG - Intergenic
1097476594 12:60064662-60064684 ATGGAGAAGAAAAATGGTATCGG - Intergenic
1097511143 12:60541972-60541994 AGAGAGAAAGAAAATGATATAGG + Intergenic
1098059783 12:66549286-66549308 GTGCAGAAGCAAAATGATAAAGG + Intronic
1098712962 12:73790353-73790375 AGAGAGAAGGAAAGTGATATAGG - Intergenic
1098755541 12:74358172-74358194 AGAGAGAAGGAAAATTATATAGG + Intergenic
1099907251 12:88786111-88786133 AGCAAGAAGAAAAGTGATATAGG + Intergenic
1101220637 12:102635578-102635600 AGGTATATGCAAAATGCTATAGG - Intergenic
1101649719 12:106666007-106666029 AGGGAGAAGGAAATTGATATAGG - Intronic
1102397979 12:112603787-112603809 AGGGCGAAGAAAAATGAGACTGG - Intronic
1102611622 12:114117464-114117486 AGGGAGAAGAACCATGATAGAGG + Intergenic
1103282685 12:119772917-119772939 AGAGAGAAGGAAAAGGAGATAGG + Intronic
1103744089 12:123110493-123110515 AGGGAGAAGCACAATGGGAGAGG + Intronic
1104363620 12:128156479-128156501 AGGAAGAAGAAAACTGATATAGG - Intergenic
1104726498 12:131079055-131079077 TGGCAGAAGCAAAACTATATAGG - Intronic
1104772689 12:131373264-131373286 AGGGACCAGAAAAATGATAAAGG - Intergenic
1105294978 13:19080281-19080303 AGAGAAAAGGAAAATGATATAGG + Intergenic
1105770109 13:23601492-23601514 AGACAGAAGGAAAATAATATAGG + Intronic
1105828464 13:24143319-24143341 TGGGAGAAGTAAAATGAGAAAGG - Intronic
1105838252 13:24229916-24229938 TGGTAAAAGCAAAATGCTATGGG + Intronic
1106007907 13:25788212-25788234 AGGGTGAAGTAAAATCATACAGG + Intronic
1106461230 13:29971876-29971898 AGAGAGAAGGAAAATTATACAGG - Intergenic
1106671261 13:31907770-31907792 AGAGCGATGCAAAATGATATTGG - Intergenic
1106671389 13:31909319-31909341 AGAGAGAATCAAAAGGAAATAGG + Intergenic
1107000954 13:35544945-35544967 AGGCACAAGCTAGATGATATGGG + Intronic
1107160700 13:37223924-37223946 AGAGAGAAGGAAAATAACATAGG - Intergenic
1107365138 13:39663911-39663933 AGGGATATGCAAAATTATCTAGG + Intronic
1108665626 13:52627349-52627371 AGTGAAAAGCAAAATGATTTTGG - Intergenic
1108835469 13:54541343-54541365 AAGGAGAAGGAAAACTATATAGG - Intergenic
1108836133 13:54551702-54551724 AGAGAGAAGGAAAATAATGTAGG - Intergenic
1109509553 13:63352003-63352025 AGGAATAAGCATAATAATATTGG + Intergenic
1110538000 13:76674494-76674516 AGGCAGAAGGAAAATAACATTGG + Intergenic
1110827136 13:79985687-79985709 AGAGAGAAGAAAAATGATACCGG - Intergenic
1111249194 13:85581095-85581117 AGTTAGAAGCAAAATGATCCTGG - Intergenic
1111597593 13:90431457-90431479 AGGCAGAAGGTAAATGTTATAGG - Intergenic
1111674135 13:91366420-91366442 AGGGAGAAGGAATGTGAAATAGG + Intergenic
1111956873 13:94768825-94768847 GGGGAGTAGCAAGATGAGATGGG + Intergenic
1112213848 13:97409673-97409695 AGGGAAAAACAAAATGATATTGG - Intergenic
1112699793 13:101993361-101993383 AGAGAGAAGGAAAACAATATTGG + Intronic
1112798683 13:103086523-103086545 AGGCTGAACCAAAATGATTTTGG + Intergenic
1113186740 13:107695503-107695525 AGGAATAAGCAAAATCATTTGGG - Intronic
1113754146 13:112797784-112797806 AGAAAGAAGGAAAATTATATAGG + Intronic
1114733255 14:25017258-25017280 AGGGAGAAAGAATATGAAATAGG + Intronic
1114766022 14:25371468-25371490 AGACAGAAGAAAAATGAGATTGG + Intergenic
1114928264 14:27432933-27432955 AGAGAGAAACAGAATGATAAAGG + Intergenic
1114978794 14:28135743-28135765 AGAGAGAAGCCACATGAGATAGG - Intergenic
1115450975 14:33546924-33546946 AGGAAAAGGCAAAATAATATTGG + Intronic
1115720067 14:36151007-36151029 AGGGAGAAGAAAAATGATATAGG - Intergenic
1115913783 14:38286684-38286706 AGGGAGAGGCACAATCATTTGGG + Intergenic
1116083904 14:40209762-40209784 AGGGAGAAGAACAATGATACAGG + Intergenic
1116088979 14:40279534-40279556 AGGCAGAAGAAAAATAATATAGG - Intergenic
1116236987 14:42291793-42291815 AGAGAGAAGAAAAATGATATAGG + Intergenic
1116246660 14:42423630-42423652 TGTAAGAAGCAAAATTATATTGG + Intergenic
1116379079 14:44241998-44242020 AGGGAGAAGGAAAATAATATAGG + Intergenic
1116442794 14:44973636-44973658 AGAGAAAAGGAAAATTATATAGG - Intronic
1117469652 14:56029618-56029640 AAAGAAAAGCAAAATGACATAGG + Intergenic
1117607963 14:57451081-57451103 AGAGAGAAGAAAAATGATATAGG - Intergenic
1117642613 14:57816137-57816159 AGGGAGAATCACAATGATGGTGG + Intronic
1118841192 14:69513724-69513746 AGGGAGAAGGAAAATGATATAGG - Intronic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1120111648 14:80564395-80564417 AAGGAGAAGCCATATGATATAGG + Intronic
1121264571 14:92591840-92591862 AGAGAGAAAGAAAATGATAAAGG + Intronic
1121372462 14:93372070-93372092 AGAGAGAAGGAAAATAATATAGG + Intronic
1122137180 14:99640831-99640853 AGGGAGAAAGAAGATGATATAGG - Intergenic
1122380572 14:101302300-101302322 AGAGAGAAGGAAAATGAAATAGG + Intergenic
1122819940 14:104336595-104336617 AGGAAGAGGGAAAATGATCTAGG + Intergenic
1123895043 15:24820347-24820369 AGGTAGAAGGTAAATGAAATGGG + Intergenic
1124073374 15:26416662-26416684 AGGCAGAAGGAAAATGACATAGG + Intergenic
1124088340 15:26573382-26573404 AGAGAGAAGAAAAATGGGATTGG + Intronic
1124171665 15:27379551-27379573 AGAAAGACGGAAAATGATATAGG - Intronic
1124710061 15:32001489-32001511 AGAGAGAAGGAAAATGACATAGG + Intergenic
1125135777 15:36341170-36341192 AGAGGGAAGAAAAATGTTATAGG - Intergenic
1125792703 15:42381254-42381276 AGGGAGAAGAAAAATGATACAGG - Intronic
1126331371 15:47535373-47535395 AGGAAGAGGCAAAGAGATATGGG + Intronic
1126611505 15:50534031-50534053 ACAGAGAAGGAAAATGATATAGG + Intronic
1127126661 15:55818920-55818942 AGGGAGAAGCACAATGAAAATGG - Intergenic
1127162931 15:56209435-56209457 AGAGAGAAGGAAAATAATAAAGG + Intronic
1127164237 15:56227837-56227859 AGAGAGAAGGAAAATGATAAAGG - Intronic
1128723666 15:69972009-69972031 GGGGAGAATCAAAAGGATTTGGG + Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1129095587 15:73203957-73203979 AAGCAGAAGGAAAATGATATAGG - Intronic
1129302723 15:74635231-74635253 AGGGAGAAGCATAAGGGGATGGG + Intronic
1130199706 15:81813602-81813624 AGGAAGAAGGAAACAGATATAGG - Intergenic
1130329057 15:82905823-82905845 AGAAAGAAGGAAAATGAGATAGG + Intronic
1130443924 15:83981164-83981186 TGGGAGAAGGACAGTGATATGGG - Intronic
1130545514 15:84855331-84855353 GAGGAGGAGCAAAGTGATATGGG - Intronic
1131362965 15:91810706-91810728 AGAGAGAAGGAAAATAATATGGG + Intergenic
1131574691 15:93575981-93576003 AGTGATAAGGAAAATAATATAGG - Intergenic
1131964426 15:97826141-97826163 AGAGAGAAGGAAAATAATATAGG - Intergenic
1133839947 16:9398835-9398857 AGGGAGAGACCAAATGATTTTGG + Intergenic
1135764369 16:25164800-25164822 AGGCAGAAGGAAAAGGATAAGGG - Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1135887721 16:26326601-26326623 AGAGAAAAGAAAAATGATATAGG + Intergenic
1137258859 16:46804973-46804995 AAAGAAAAGCAAAATGATATTGG - Intronic
1138176530 16:54903649-54903671 AGAGAGAAGAAAACTTATATAGG + Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138781206 16:59790189-59790211 AGGCAGAAGGAAAATGATACAGG - Intergenic
1138790142 16:59894066-59894088 AGAAAGAAGAAAAATAATATAGG - Intergenic
1138889974 16:61129660-61129682 AGAGAGAAGAAAAATGACATAGG - Intergenic
1138985953 16:62328721-62328743 ATGGAAAGGCAAAATGTTATAGG - Intergenic
1139121954 16:64031006-64031028 AGAGAGAAGAAAAATAATACAGG - Intergenic
1139128494 16:64111519-64111541 AGAGAGGAGGAAAATGATATGGG - Intergenic
1139232587 16:65298869-65298891 AGAGAGAAGAAAAATGATTTGGG + Intergenic
1139612614 16:68069828-68069850 AGGGAAAAGCAACATGACCTTGG + Intronic
1140150300 16:72356539-72356561 AGCAAGAAGCAAAATAATAGAGG + Intergenic
1140571174 16:76107990-76108012 AGGAAGAAACAAACTGATGTGGG + Intergenic
1140912163 16:79464095-79464117 AGGTAGAAGCAAAATAAGAGTGG - Intergenic
1141137597 16:81476812-81476834 AGGGAGAAGAAACAGGAAATGGG - Intronic
1143278627 17:5733257-5733279 AGGCAGAAGATAAATAATATAGG - Intergenic
1143612918 17:8030296-8030318 AGGGCTAAGCAGAATGAGATAGG - Intergenic
1143873461 17:9974445-9974467 TGGGGGAAGAAAAATGAAATTGG + Intronic
1143940903 17:10540417-10540439 AGGGGTAAGCAAAATGTTATAGG + Intronic
1144048843 17:11479916-11479938 AGAGATAAGGAAAATGATATAGG - Intronic
1144274384 17:13651684-13651706 AAGTATAAGCAAAATAATATAGG + Intergenic
1145100544 17:20073022-20073044 AGGGAGCTCCAAAATGATATGGG - Intronic
1145410276 17:22654678-22654700 AGGGATATTGAAAATGATATGGG - Intergenic
1146546742 17:33746040-33746062 AGACAGGAGCAAAATCATATTGG + Intronic
1146986702 17:37227015-37227037 AGGAAGAAGAGAAATGATTTGGG - Intronic
1147650779 17:42060679-42060701 AGGGAGAGGCAAACTGACATGGG - Intronic
1149216672 17:54362872-54362894 ACTGAGAAGCAAACTGGTATTGG + Intergenic
1149278318 17:55071091-55071113 AGGGAGAAGAAAAAGGAGATGGG - Intronic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149693118 17:58595053-58595075 ATGGTGAAGCATCATGATATAGG - Intronic
1149919142 17:60639910-60639932 AGGAAGAAGCATAGTGATATAGG + Intronic
1150614418 17:66758039-66758061 AGAGAGAAGGAAAGTGACATAGG + Intronic
1152940363 17:83168898-83168920 AAGGAGAAGGAAAATAATGTAGG - Intergenic
1153200390 18:2641694-2641716 AGGGACAAGTAAATTGATCTGGG - Intergenic
1153297474 18:3561493-3561515 TGAGAGAAGGAAAATGACATAGG - Intronic
1153532466 18:6062107-6062129 AGAGAGAAGGAAAATTATATGGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154112529 18:11582437-11582459 AGGGAGATGGAAAATCATAGAGG + Intergenic
1154114505 18:11599864-11599886 AAAGAGAAGGAAAATTATATGGG + Intergenic
1154232152 18:12566367-12566389 AGAGAGAAAGAAAATAATATGGG + Intronic
1154253025 18:12759779-12759801 AGAGAGAAGGAAAATGATATAGG + Intergenic
1156509588 18:37625318-37625340 AGGGAGAAGCAAAATCCTCATGG - Intergenic
1156640079 18:39084146-39084168 AGGAAGAAGAAAAATGTTAATGG - Intergenic
1156687516 18:39667947-39667969 ATGGAGAGGCAGAATGGTATGGG - Intergenic
1157284978 18:46371486-46371508 AGGGAGAAGTTAAAGGAGATTGG + Intronic
1157900485 18:51510855-51510877 AGGCAGAAGGAAAATGATATTGG - Intergenic
1158013623 18:52757906-52757928 ATTGAGAAGCAAAGTGATAAGGG - Intronic
1158451059 18:57565691-57565713 AAGGAGAATCAAAAGGCTATTGG - Intronic
1159049360 18:63404340-63404362 AGGGAGAAGGAAAAGGAGAGAGG + Intronic
1159231692 18:65616163-65616185 ATTGAAAAGGAAAATGATATAGG - Intergenic
1159345130 18:67192271-67192293 ATGGAGAAACAAAAAGAGATGGG - Intergenic
1159373275 18:67557814-67557836 AGAGAGAAGAAAAATGATACAGG - Intergenic
1160445179 18:78922060-78922082 AGGGAGAGGTAAAATGAGAGCGG - Intergenic
1162687130 19:12396884-12396906 AGAGAGAAGAAAAATGATACAGG + Intronic
1162691457 19:12436711-12436733 AGAGAGAAGAAAAATGTTACAGG + Intronic
1162991757 19:14307416-14307438 GGGGAGAAGAAAAATGAGACAGG - Intergenic
1163292624 19:16389522-16389544 AGGCTGAAGGAAAATGATAATGG + Intronic
1165320797 19:35084045-35084067 AAGGAGAAGCCAAATGTTCTAGG + Intergenic
1165647921 19:37459580-37459602 AGGCAGAAGAAAAACAATATAGG + Intronic
925316325 2:2928671-2928693 AGAGAGGAGGAAAATGATATAGG - Intergenic
925488410 2:4363406-4363428 AGGGAGAAGCTCCATGACATTGG - Intergenic
926103771 2:10137551-10137573 AGGTAGAAGCAAACTGAAAGTGG - Intergenic
926451638 2:13011345-13011367 AGGTAGAAGAAAAATGAAATAGG - Intergenic
927131026 2:20060839-20060861 GAGGAGGAGCAAAAAGATATTGG + Intergenic
928054196 2:28034751-28034773 AGGAAAAAGAAAAAAGATATTGG + Intronic
928102641 2:28448491-28448513 AGGAAGAAGCAAAAACATATCGG + Intergenic
928165732 2:28970605-28970627 AGGGAGAAGCAACTTGATATAGG - Intronic
928342269 2:30454938-30454960 AAAGAGAAGCTAAATTATATAGG - Intronic
928452896 2:31394157-31394179 AAAGAGAAGGAAAATGATGTAGG - Intronic
929051045 2:37837110-37837132 AGGTAGTAGCATAATGATCTGGG - Intergenic
929102288 2:38327169-38327191 AGCAAAAAGGAAAATGATATAGG + Intronic
929767666 2:44861085-44861107 AGAGAGAAGGAACATGATATAGG + Intergenic
931321018 2:61175168-61175190 AGGAAGACGCAAAATAATGTTGG - Intergenic
931938038 2:67219620-67219642 AGGATGAATCAAAATGATCTGGG - Intergenic
932107899 2:68964616-68964638 AGGCAGAAGGAAAAGGATATAGG + Intergenic
932314676 2:70772008-70772030 AGGGAGTGGGAAAGTGATATAGG - Intergenic
932936365 2:76107642-76107664 AGGGAGAAGGAAAATGATATAGG - Intergenic
932980410 2:76658477-76658499 AGAGAGAAGAAAAACGAAATAGG - Intergenic
933161678 2:79031020-79031042 TGGGAGAAGGGAAATGATATAGG + Intergenic
933710303 2:85320372-85320394 AGAGAGAAGCAAAATGGGCTGGG + Intronic
933783715 2:85820938-85820960 AGAGAAAAGGAAAATGATATAGG + Intergenic
933885250 2:86713297-86713319 AGAGAGAAGGAAAATGATGTAGG + Intronic
933887345 2:86730733-86730755 AGAGAGAAGAAAAAAGATACAGG - Intronic
933922830 2:87065980-87066002 AGAGAGAAGAAAAAAGATACAGG + Intergenic
933924924 2:87083386-87083408 AGAGAGAAGGAAAATGATGTAGG - Intergenic
934486457 2:94717516-94717538 AGGGAGAAGAAAAAGGGTATAGG - Intergenic
934973506 2:98783330-98783352 AGGGAGAAGGAATATGATAAAGG + Intergenic
935231128 2:101097323-101097345 AGAGAGAAAGAAAATGACATAGG + Intronic
935461858 2:103345797-103345819 AAGCAGAAACAAAATAATATAGG - Intergenic
935663622 2:105490534-105490556 AGGGACAACCACAATGAAATAGG + Intergenic
935824272 2:106928452-106928474 AGAGAGAAAGAAAATGATACAGG - Intergenic
936070119 2:109363590-109363612 GGAGAGAAGAAAAATAATATAGG - Intronic
936465479 2:112744993-112745015 AGGAAGAAGAAAACTAATATGGG + Intronic
936809669 2:116382784-116382806 AGGCAGAAGAAAAATGATAGAGG - Intergenic
937487482 2:122330491-122330513 AGGAAGAAGGAAAATTCTATAGG + Intergenic
938176607 2:129138476-129138498 AAGGAGAAGGAAAGTAATATAGG - Intergenic
938465933 2:131525245-131525267 AAAAAGAAGGAAAATGATATAGG - Intergenic
939223252 2:139331133-139331155 AATGAGAATGAAAATGATATAGG + Intergenic
939279244 2:140040715-140040737 AGAGAGAAGAAAAATGTCATAGG + Intergenic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
939846375 2:147251358-147251380 AGGGAGAAGCAAATGGGTAGAGG + Intergenic
939976378 2:148721158-148721180 TGAGAGGAGGAAAATGATATAGG - Intronic
940120776 2:150262510-150262532 AGGCAGAAAGAAAATGATATAGG + Intergenic
940125456 2:150318108-150318130 AGGCAGAACAAAAATGATCTTGG + Intergenic
940513487 2:154649575-154649597 AAGACGAAGCAAAGTGATATGGG - Intergenic
940553874 2:155197457-155197479 AGGAAGCAGCAAAATGAATTGGG + Intergenic
940641802 2:156352603-156352625 ACCCATAAGCAAAATGATATAGG - Intergenic
940663335 2:156574941-156574963 AGAGAGAAGGAAAAAGACATTGG - Intronic
941280627 2:163546280-163546302 AGGTTGAAACGAAATGATATTGG - Intergenic
941402704 2:165049983-165050005 AGAAAGAAGGAAAATAATATAGG + Intergenic
941570798 2:167167867-167167889 AGAAAGAAGAAAAATGATATAGG - Intronic
942282430 2:174379241-174379263 AGTGAGAGGCAAAAAGAAATGGG - Intronic
942377192 2:175349664-175349686 AGGAAAAAGCAAAATGAACTTGG + Intergenic
943456155 2:188110125-188110147 AGGCAGAAGGAAAATGATACTGG - Intergenic
943582386 2:189700096-189700118 AAAGAGAAGAAAAATGATATAGG - Intronic
944433001 2:199656743-199656765 AGAGAGAAGAAAAATTATATAGG - Intergenic
944726570 2:202477296-202477318 TGGTAAAAGGAAAATGATATGGG - Intronic
944926314 2:204468318-204468340 AGGATGAAGGAAAATGAAATAGG + Intergenic
945309361 2:208293415-208293437 AGAGAGAAGGAATATGATATAGG - Intronic
945543221 2:211115291-211115313 AGGGAGAAGCCAAATCATTCAGG - Intergenic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
946055626 2:216899513-216899535 AGAGAAAAGGAAAATTATATAGG - Intergenic
947106468 2:226673095-226673117 AGGGAGAAAAAAAATGAAAAGGG - Intergenic
947960281 2:234230466-234230488 AGGGAGAAGAGAAATGAGCTTGG + Intergenic
948131691 2:235605514-235605536 AGGGAGAAGATAAATGATGCCGG - Intronic
948546686 2:238737063-238737085 AGGGAGAAGAAAAATCATATAGG - Intergenic
948549004 2:238755422-238755444 AGGGAAGGGCAAAATGTTATGGG - Intergenic
948967178 2:241391957-241391979 AGGGAGATGCTAAAGAATATAGG + Intronic
1168988179 20:2069345-2069367 AGAGCGAAGAAAAATTATATAGG + Intergenic
1169081953 20:2802757-2802779 AGGGAGAGGCAAAATATTTTGGG - Intergenic
1169110094 20:3027069-3027091 AGGGAGAGGACAAATGATATTGG + Intronic
1169430757 20:5534093-5534115 AGGCAGAAGCACAATTGTATGGG + Intergenic
1170589001 20:17757023-17757045 AGGGAGAAGCAGAAAGATACGGG - Intergenic
1170721213 20:18880857-18880879 AGCAAGAAGGAAAATGATAAAGG - Intergenic
1170973598 20:21140121-21140143 AGGAAGAAGCAGAAAGAAATGGG - Intronic
1174956982 20:55108646-55108668 AGGAAGAAGAAAAATTATATAGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1175620535 20:60443186-60443208 AGGCAGAAGAAAAATGACAATGG - Intergenic
1177057093 21:16319437-16319459 AGGGAGAAGCAGCGTTATATCGG + Intergenic
1177117221 21:17100981-17101003 AGAGAGATACAAAGTGATATTGG - Intergenic
1179390378 21:40983717-40983739 AGGAAGAAGGCAAATGATATAGG + Intergenic
1180114283 21:45687345-45687367 AGGAGGAATTAAAATGATATAGG + Intronic
1182609942 22:31539106-31539128 AGGTTGAAGCAACATGATTTTGG - Intronic
949619156 3:5790503-5790525 AAGGAGGAGTCAAATGATATAGG + Intergenic
949744569 3:7274384-7274406 AGAGAGAAGAAAGGTGATATAGG - Intronic
949817959 3:8081240-8081262 AATCAGAATCAAAATGATATTGG - Intergenic
950707572 3:14792569-14792591 AGAGAGAAGCAAAAGGCTTTTGG + Intergenic
950825812 3:15819524-15819546 AGGTATAAACAAAATAATATTGG + Intronic
951134073 3:19083251-19083273 AGAGAGAAAGAAAGTGATATAGG + Intergenic
951504400 3:23426749-23426771 AGAGAGAAGGAAAATGACATAGG + Intronic
952352689 3:32555684-32555706 AGAGAGTAGCATAATGAGATCGG - Intronic
952426785 3:33183726-33183748 AGGGAGCAGGGAAATGATATAGG - Intronic
952473252 3:33678651-33678673 AGAGAGAAGGAAAATGATACAGG + Intronic
952628407 3:35435989-35436011 AGAAAGAAGAAAAATTATATGGG - Intergenic
952633417 3:35497656-35497678 AGAGAAAAGGAAAATGACATTGG - Intergenic
953193040 3:40707200-40707222 GGAAAGAAGGAAAATGATATAGG - Intergenic
954978307 3:54718616-54718638 TTGAAGAATCAAAATGATATTGG - Intronic
955031435 3:55224738-55224760 AGAGAGAAGTAAAAAGTTATTGG + Intergenic
955777835 3:62452592-62452614 CAGGAGAAGAAAAAAGATATGGG + Intronic
956238237 3:67099176-67099198 GGGTAGAAGAAAAATGATATAGG + Intergenic
956812572 3:72878420-72878442 AGAGAGAAGGAAAATGATGTAGG - Intergenic
957016966 3:75077711-75077733 AGAGAGAAGGAAAATGATATAGG - Intergenic
957120713 3:76087533-76087555 AGAAAGAAGGAAAATGATACAGG + Intronic
957181179 3:76879854-76879876 AGGTAAAAGCAAAAATATATTGG + Intronic
957645764 3:82923182-82923204 AGAGAGAAGGTAAATGATAGAGG + Intergenic
958645817 3:96872454-96872476 GGAGAGAAGAAAAATGAAATAGG - Intronic
959258663 3:104048033-104048055 AGGGAAGAGCAATATGGTATGGG + Intergenic
959649851 3:108741128-108741150 TGGCAGAGGCAAAGTGATATTGG - Intergenic
959927930 3:111945717-111945739 AAGGAGAAGCAAAATAAGAGAGG - Intronic
960083595 3:113567443-113567465 GGAGAGAAGCAAAATGAGATAGG + Intronic
960136331 3:114109220-114109242 TGGGAGGAGGAAAATGTTATAGG + Intergenic
960188230 3:114670788-114670810 TGGTAGAAGCAAAATGCTGTGGG + Intronic
960749771 3:120935496-120935518 AGAAAGAAGGAAAATGATATGGG - Intronic
962153271 3:132915883-132915905 ACAAAGAAGAAAAATGATATAGG - Intergenic
962860559 3:139396585-139396607 AGGGTGAAACGAAATGATACAGG + Intergenic
963242781 3:143026045-143026067 TGGGAAAAGCAAAAGGATATTGG - Intronic
963330411 3:143909087-143909109 AGAGAGAAGGAAAATAATATAGG - Intergenic
963773803 3:149418328-149418350 TGTGAGAAAAAAAATGATATTGG + Intergenic
963824760 3:149940553-149940575 AAAGAGAAGAAAAATGATATAGG - Intronic
963849174 3:150192564-150192586 AGAGAGAAAAAAAATGATACAGG - Intergenic
964322664 3:155514319-155514341 AGGCAGAAGGAAGATCATATGGG - Intronic
964646502 3:158963697-158963719 AAGGAGAAGCAAAATTTGATGGG + Intronic
964852643 3:161111622-161111644 AGAGAGAAGGAAAATAATAGAGG + Intronic
966275544 3:178161547-178161569 AGAGAGAAAGAAAATGATATAGG + Intergenic
966571154 3:181444972-181444994 AGGTAAAGGCAAAAAGATATTGG - Intergenic
966669238 3:182508524-182508546 AGGGAGAGGCATAAAAATATGGG - Intergenic
967079807 3:186038901-186038923 AAAGAGAAGAAAAATGATTTTGG + Intergenic
967274542 3:187761025-187761047 AGGGAGAATCAAGATCATTTAGG + Intergenic
967721278 3:192819164-192819186 AGGGAGAAGAAAAGAGAGATAGG + Intronic
968248840 3:197185731-197185753 GGGGAGGAGAAAACTGATATGGG + Intronic
968534855 4:1118079-1118101 AGAAAGAAGGAAAATGATGTAGG + Intergenic
969866012 4:10077503-10077525 AGGGATAAGCGAGGTGATATGGG - Intronic
969997856 4:11332925-11332947 AGGGAGAGGCAAAAGGAAAAGGG - Intergenic
970186936 4:13465661-13465683 AGGGAGAAGGAAAATGATATGGG + Intronic
970389829 4:15597208-15597230 AGAGAGAAGAAAAATGAAATTGG + Intronic
971090549 4:23338713-23338735 AGAGAGAAGAAAACTGATGTAGG + Intergenic
971249356 4:24959919-24959941 AGGCAGAAGGAAAATGATACCGG + Intronic
971577799 4:28298988-28299010 AGAGAGAAGGAAAATGATATAGG - Intergenic
971629981 4:28978565-28978587 AGTGAGAAGCTAAAAGACATAGG + Intergenic
972047761 4:34690306-34690328 TGGGAGAAGAAAAAAGATTTGGG + Intergenic
972109362 4:35537592-35537614 AGTTTGAAGCAAAATGTTATGGG + Intergenic
972211570 4:36844028-36844050 AGGGAGAATCAACATGACAGTGG + Intergenic
972465553 4:39352820-39352842 AGGAAGAGGGAAAATGATACAGG - Intronic
973896156 4:55415373-55415395 AGTGAGGAGCAAAATCAAATGGG - Intronic
974308025 4:60166947-60166969 AGGGAGAAGAAAGATTATATTGG + Intergenic
974488936 4:62539058-62539080 AGAGAGAAGGAAAATTATGTAGG + Intergenic
974632050 4:64505248-64505270 AGAGAGAAAAAAAATTATATAGG + Intergenic
975106899 4:70577783-70577805 AGGTACAAGCAAAATAATAGAGG - Intergenic
976299975 4:83508031-83508053 AGGGAGCAGAAAAATGAAGTGGG + Intronic
976555455 4:86445875-86445897 AGAGAGAAGAAAAATAATATAGG + Intronic
976587236 4:86812490-86812512 AGAGAAAAGAAAAATGAAATAGG + Intronic
977692082 4:99924214-99924236 AGTGACAGGCAAAATGATCTAGG + Intronic
978052643 4:104221435-104221457 AGGGAAAAGAAAAATGATCCTGG - Intergenic
978129363 4:105176069-105176091 AGAGAGAGGTAAAATGATACAGG + Intronic
978308539 4:107359685-107359707 ATGCAAAAGTAAAATGATATTGG - Intergenic
978312920 4:107405641-107405663 ATGGAGGAGGAAAATGAAATAGG + Intergenic
978526200 4:109669153-109669175 AGAGAAAAGCAAGATGATATAGG - Intronic
978658068 4:111090171-111090193 AGAGATAAAGAAAATGATATAGG + Intergenic
978876353 4:113644755-113644777 AGGGAGAAGCTAAAATATCTGGG - Intronic
978943509 4:114466182-114466204 AGGGAGAATGAGAATGATAGGGG + Intergenic
979045246 4:115854248-115854270 AGGGAGATGCATAATGGTAAGGG + Intergenic
979658421 4:123223997-123224019 AGGGAAAAGCTTAATGACATTGG - Intronic
980487483 4:133477755-133477777 AGTGAGAAGGAAAATGACATAGG + Intergenic
980740353 4:136942216-136942238 AGAGACAAGAAAAGTGATATAGG + Intergenic
981056076 4:140362889-140362911 TGGGAGAAGCAAACTGGGATGGG + Intronic
981902576 4:149884060-149884082 AGGGAAAAAAAAAATGAAATTGG + Intergenic
982590765 4:157306828-157306850 AAGCATAAGCAAAATGATTTCGG - Intronic
983075342 4:163318664-163318686 AGAGAGAAGGAAAATATTATAGG - Intergenic
983430057 4:167638070-167638092 AGAGAGAAGGAAAATGATATAGG - Intergenic
983462000 4:168037044-168037066 AGTGAGAAGGACAATGGTATGGG + Intergenic
983520066 4:168698891-168698913 AAGGAGAAGGAAAATTAAATTGG + Intronic
983579668 4:169295022-169295044 AGAGAGAAGAAAAATGATACAGG + Intergenic
983918621 4:173319820-173319842 AGAGATAAGCAAAATGCCATAGG + Intronic
984176096 4:176418570-176418592 ATGGAGAAGGAAAATAGTATAGG - Intergenic
985377039 4:189351969-189351991 ATGCAGAAGAAAAATTATATAGG + Intergenic
985382602 4:189410982-189411004 AGGAAGAAGGAAAATAATATTGG - Intergenic
985953931 5:3247525-3247547 AGAGAGAAGAAAAATAATATAGG - Intergenic
986897360 5:12385975-12385997 AGGTAGAAGGAATATGACATAGG - Intergenic
987324353 5:16799001-16799023 TGGGGCATGCAAAATGATATGGG - Intronic
987723436 5:21666687-21666709 AGGGAAAAGCAAAATTATATAGG - Intergenic
988199316 5:28049278-28049300 AAGGAGTGGCAAAATGATTTAGG - Intergenic
988243495 5:28645562-28645584 AGAGAGGAGGAAATTGATATAGG + Intergenic
988253450 5:28791557-28791579 AGAGAGAAGGAAAAAGATACAGG - Intergenic
988500625 5:31780774-31780796 AGTGAGAGGGAAAATGAGATTGG - Intronic
989298802 5:39864004-39864026 AGGGAGAGGCAAGATGAAATAGG - Intergenic
989554399 5:42775572-42775594 GGAGAGAAGCAAAATGATATAGG + Intronic
989652106 5:43702365-43702387 AGGGAGAAGCATAATAATGCAGG + Intronic
989723920 5:44564549-44564571 AGAGAGAAGGAAAATTATATAGG - Intergenic
989814284 5:45717645-45717667 AGGGAGAAGGAAAAGGACAATGG - Intergenic
990244048 5:53845004-53845026 AGAAAGAAGGAAAATTATATAGG + Intergenic
990472778 5:56131835-56131857 GAAGAGAAGAAAAATGATATAGG + Intronic
990571171 5:57080362-57080384 AGAGAGAAGGAAAATAATGTAGG - Intergenic
990625776 5:57609124-57609146 AGAGAGAAGAAAAATAATATAGG + Intergenic
990746862 5:58967426-58967448 ATGGAGACGAAAAAAGATATTGG - Intergenic
991542746 5:67747929-67747951 AGAGACAAGGATAATGATATAGG + Intergenic
991962670 5:72061544-72061566 AGTTAGATGCAAAATGTTATAGG + Intergenic
992389332 5:76315789-76315811 AGGGAGAAGAAAAAAGGGATGGG + Intronic
992592763 5:78312637-78312659 AGAGAGAAGGAAAATAATCTAGG + Intergenic
992637725 5:78741006-78741028 AGGGAGCATCAAGATCATATTGG + Intronic
993007707 5:82446209-82446231 AGGAAGAAGAAAAATGTTGTTGG + Intergenic
993241911 5:85399816-85399838 AGAGAGAAGGAAACTGATATAGG + Intergenic
994943396 5:106354693-106354715 TGGGAGAAGAAAAATAATATAGG - Intergenic
994956778 5:106543058-106543080 AGAGAGAAGCAACATTAAATAGG - Intergenic
995145159 5:108780221-108780243 AGGGGGAAGAAAAATGATAGAGG - Intronic
995188866 5:109299376-109299398 AGGGAGAAGGAAGACGATAAGGG - Intergenic
996801994 5:127414641-127414663 AGGGAGAAGCAGATTAATGTGGG + Intronic
997218236 5:132132968-132132990 AGGGAGAAGGAAAATGATATAGG - Intergenic
997292097 5:132744822-132744844 AGAGAGAAGGAAAATGATATAGG - Intergenic
997546705 5:134714057-134714079 ATGGAGAAGAAAAAAGTTATGGG - Intronic
998961519 5:147492290-147492312 AGAGAAAAGGAAAATGATATAGG + Intronic
999104585 5:149059791-149059813 AGAGAGAAGGAGAATGAGATTGG + Intronic
999306984 5:150525840-150525862 AGGGCAAAGCAAAATGAGTTTGG - Intronic
999498680 5:152125246-152125268 AGGGAGAAGCTAAGTGGTGTGGG - Intergenic
999521706 5:152357649-152357671 ATGGAGGACCAACATGATATGGG + Intergenic
999565065 5:152850493-152850515 AAAGGGAAGAAAAATGATATGGG - Intergenic
1000054274 5:157590899-157590921 AGGGAGAATGAAATTGATAAAGG - Intergenic
1000421413 5:161042238-161042260 AGGGAGAAAGAAAATGACAGAGG - Intergenic
1001189431 5:169614344-169614366 AGAGAGAAGAAAAATGATATAGG + Intergenic
1001377156 5:171271875-171271897 AGTGGGAAGAAAAATAATATTGG + Intronic
1001869845 5:175142463-175142485 TGGGAGAAGGAAAATGACATAGG + Intergenic
1002084588 5:176765234-176765256 AGAGAGAGGAAGAATGATATGGG - Intergenic
1002214022 5:177616674-177616696 AGGGAGAAGGGAAGAGATATAGG - Intergenic
1002622795 5:180500961-180500983 AGGGAGAAGGAACAGCATATTGG + Intronic
1002774502 6:317380-317402 AGCCAGAAGCAAGATGATAAAGG + Intronic
1002815024 6:671560-671582 AGGGAGAAGCAAAATGATATAGG - Intronic
1002892055 6:1342738-1342760 AGAGAAAAGGAAAATGATACAGG + Intergenic
1002970616 6:2014221-2014243 AGCGAGAAGGAAAATTATATAGG + Intronic
1003736078 6:8878964-8878986 AGGGAGAAGCAAAAGGAACACGG - Intergenic
1003748480 6:9029165-9029187 AGGTAGAAGAAAAATACTATAGG - Intergenic
1004108286 6:12687173-12687195 AGAGAGAGGTAAAAGGATATAGG + Intergenic
1004213162 6:13673407-13673429 AGAGAAAAGGAAAATGATATAGG + Intronic
1004567282 6:16809653-16809675 AGAAAAAAGAAAAATGATATAGG - Intergenic
1004705277 6:18118656-18118678 AGGGAGAAGGAGAAGGAAATAGG - Intergenic
1005128988 6:22481406-22481428 AGGGAGAAGGAAAATGATAGAGG + Intergenic
1005192157 6:23236868-23236890 AGAGAGAAGAAAAATAATATAGG - Intergenic
1005798022 6:29388514-29388536 AGGGAGAAGTAAAAAAAAATAGG - Intronic
1008703386 6:54128696-54128718 TGGGAAAACCAAAATGAGATGGG + Intronic
1009569584 6:65366839-65366861 AGGTACAAGCCAAATAATATAGG - Intronic
1009619674 6:66058250-66058272 AGGGAGAAGGAAAATCATATAGG - Intergenic
1009848977 6:69171833-69171855 AGGAAGAAAAAAATTGATATTGG - Intronic
1009887403 6:69640066-69640088 AGGCAGGAGCAAAATCATGTAGG + Intergenic
1010143404 6:72637972-72637994 AGGAATAAACAAAATGAGATGGG + Intronic
1010783933 6:79978067-79978089 AGGGGGAAGAAACATGATATAGG - Intergenic
1010857816 6:80863861-80863883 ATAGAGAAGAAAAATGAGATAGG + Intergenic
1011095072 6:83652725-83652747 AGGGAGAAGGAAAATTATATGGG - Intronic
1011695408 6:89908018-89908040 AGAGAGAAAAAAAATGATATAGG - Intergenic
1012042011 6:94218385-94218407 AGAGAGAAGAAATATGATATTGG - Intergenic
1012222809 6:96670631-96670653 AGAGAGAAGAAAAATTATGTAGG + Intergenic
1012323895 6:97889163-97889185 AAGGGAAATCAAAATGATATAGG + Intergenic
1012808894 6:103932418-103932440 AGGCAGAAGGAAAATGATATAGG + Intergenic
1013572267 6:111440717-111440739 AGAGAAAAGGAACATGATATAGG - Intronic
1013863958 6:114672032-114672054 AGAGGGAAGTAAAATGATATGGG - Intergenic
1014115853 6:117667935-117667957 AGAGAGAAGGCAAATGAGATAGG + Intergenic
1014178558 6:118357377-118357399 AGAGAGAAGGAAAATGATATAGG + Intergenic
1014227359 6:118862998-118863020 AGAGAAAAGGAAAATGACATAGG + Intronic
1014619706 6:123651431-123651453 ATGGCGAAGCTAAAAGATATTGG + Intergenic
1014697978 6:124647697-124647719 GTAGGGAAGCAAAATGATATTGG + Intronic
1016170023 6:141002027-141002049 AGGTAGAAGGAAAATGATATAGG - Intergenic
1016271508 6:142295465-142295487 AAGCAGAACCAATATGATATAGG + Intergenic
1016393220 6:143595865-143595887 AGGGAGAAGGAAAAGGTTAAAGG - Intronic
1016538906 6:145140744-145140766 AGGGTACAGCAAAATGATTTTGG + Intergenic
1016601578 6:145867477-145867499 AGAGAGAGGCAAAATGAAACAGG + Intronic
1016897139 6:149064563-149064585 AGAGGGAAGGAAGATGATATTGG + Intronic
1017051008 6:150393317-150393339 AGGGAGAAAAGAAATGATAATGG + Intronic
1017336795 6:153270539-153270561 AGTGAGAAGAAAAATGATATAGG - Intergenic
1017387022 6:153898247-153898269 AGAAAGAAGCAAAATGACAATGG + Intergenic
1017658617 6:156652898-156652920 AAACAGAAGTAAAATGATATGGG - Intergenic
1018097409 6:160401546-160401568 AGAGAGAATGAAAATGATCTAGG + Intronic
1018556556 6:165057083-165057105 ACAGAGAAGGAAAATGATATAGG + Intergenic
1018850490 6:167586707-167586729 AGGGAAAAGCTCAATGACATTGG + Intergenic
1020562673 7:9749823-9749845 AGAGAGAAGAAAAATAATATAGG - Intergenic
1020821937 7:12981106-12981128 GGGGAGAAGGGAAAGGATATTGG - Intergenic
1021272178 7:18603769-18603791 AGTGAGAAGGAAAAGGATATAGG - Intronic
1021352641 7:19613839-19613861 TGGGAGGAGAAAAATGATAGAGG + Intergenic
1021383162 7:19993367-19993389 AGGCAGAAGGGAAAGGATATAGG + Intergenic
1021548966 7:21849442-21849464 ATAGACAAGAAAAATGATATAGG - Intronic
1021717194 7:23470772-23470794 AGGAAGAAGGAAAATGCTAAAGG + Intergenic
1021802356 7:24319713-24319735 ATGCAGAAGGAAAAGGATATAGG + Intergenic
1022551302 7:31242024-31242046 GGGGAGAAGAGAAATGAGATAGG + Intergenic
1022724582 7:32969305-32969327 AGGGAAAAGCATCATGACATTGG - Intronic
1022783900 7:33616061-33616083 AGAGAAAAGGAAAATAATATAGG + Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023691571 7:42794496-42794518 AAGGAGAAGGAAAATAATATGGG + Intergenic
1024099266 7:46012985-46013007 AGGCAGAAGGAAAATTATATAGG + Intergenic
1024396412 7:48873969-48873991 AGGGAGAAGAAAAAAGAAAGTGG + Intergenic
1024487456 7:49934304-49934326 GGGGAGAAGTGAATTGATATTGG + Intronic
1024490602 7:49978417-49978439 AGGAAAAAGAAAAATAATATAGG + Intronic
1024678873 7:51662415-51662437 TGGGAGAAGCAAACTGAGCTGGG + Intergenic
1024761361 7:52600576-52600598 AGGGAGAATAAAAATAATATAGG - Intergenic
1024960768 7:54972184-54972206 AGGGAGAGGAAAAATGAGATTGG - Intergenic
1025049018 7:55718527-55718549 AGGGAAAAGCATCATGACATTGG + Intergenic
1026071722 7:67127685-67127707 AGAGAAAAGGAAAATGATACAGG - Intronic
1026273239 7:68854490-68854512 AGGGAGAAGGAGAAACATATTGG - Intergenic
1026503657 7:70964048-70964070 ATGGAGAAGTGAGATGATATGGG - Intergenic
1026705178 7:72684581-72684603 AGAGAAAAGGAAAATGATATAGG + Intronic
1027344992 7:77250309-77250331 AGAGGGAAGGAAAATTATATAGG - Intronic
1027618024 7:80448268-80448290 AGGGAGAAGAAGAATGTTCTGGG + Intronic
1027684109 7:81260084-81260106 AAAGAGAAGGAAAGTGATATAGG - Intergenic
1027710459 7:81594625-81594647 ATGAAGAAACAAAATCATATGGG - Intergenic
1027961427 7:84950771-84950793 AGGAAGAAGCAAAGTGACAGAGG - Intergenic
1028231406 7:88310424-88310446 AGGGAGATACAAAATGTTAAGGG - Intergenic
1028397699 7:90390183-90390205 AAGAAAAAGCAAAATGAAATAGG + Exonic
1028865962 7:95712227-95712249 AGAGAGAAGGAAAATGATATAGG + Intergenic
1029057008 7:97756570-97756592 AGTGAAAAGAAAAATGAGATAGG - Intergenic
1029436449 7:100566552-100566574 AGAGAGCAGCAAAGAGATATGGG + Exonic
1030040562 7:105446247-105446269 AGTGAAAAGGAAAATGATATAGG + Intronic
1030148163 7:106377348-106377370 AGGGATGAGAAAAATCATATAGG - Intergenic
1030716777 7:112816733-112816755 AGGGAGAAGGAAATTAATATTGG + Intergenic
1030755922 7:113287831-113287853 AGGGACAAATAAAATGATATAGG + Intergenic
1031279382 7:119777622-119777644 AGGGAGAAGAAAAATGACATAGG + Intergenic
1031366385 7:120905239-120905261 AGGGAGAATCAATATGAAAATGG + Intergenic
1031428196 7:121633521-121633543 AGGAGGAAGAAAAATGGTATGGG + Intergenic
1031666929 7:124496103-124496125 AGGGAGAATCAATATGAAAATGG - Intergenic
1031879050 7:127175861-127175883 AAGGGGAATGAAAATGATATAGG + Intronic
1031964534 7:128018178-128018200 GAGGAGAAACAAATTGATATAGG + Intronic
1032007607 7:128315855-128315877 AGAGAGAAGAAAAATGACATAGG + Intronic
1032411812 7:131699738-131699760 AGGTAGAAGCATAAGGATGTGGG + Intergenic
1032536206 7:132666798-132666820 AGAGAGAAGGCAAATGATCTGGG + Intronic
1033985574 7:147221717-147221739 GGAGACAAGGAAAATGATATAGG - Intronic
1034375937 7:150644086-150644108 AGAGAGAAGAAAACTGATATGGG - Intergenic
1037092234 8:14934658-14934680 AGGGAAAAACAAAATGTTAAGGG + Intronic
1037254418 8:16936345-16936367 AGAGAGAATAAAAATGACATAGG + Intergenic
1037925036 8:22837785-22837807 AGGTACAAGCAAAATGCTATTGG - Intronic
1038061260 8:23915892-23915914 AGGGAGAAGAAAAATAGTATAGG - Intergenic
1038512279 8:28150334-28150356 AGAGAGAAGGAAAATGATATGGG - Intronic
1038702847 8:29865431-29865453 AGAGAGAAGAAAATTAATATAGG + Intergenic
1039695605 8:39907122-39907144 ATGGAGAAAAAAAATGATATAGG + Intronic
1039731071 8:40279165-40279187 AGACAGAAGGACAATGATATAGG - Intergenic
1039860134 8:41450078-41450100 AGAGAGCAAGAAAATGATATAGG - Intergenic
1039942797 8:42105592-42105614 AGGGAGATACAAAATGAGAAGGG + Intergenic
1040393733 8:46974711-46974733 AGGGAGAAGAAAAATAATTATGG + Intergenic
1040419813 8:47228329-47228351 AGAAAAAAGGAAAATGATATAGG + Intergenic
1040722282 8:50339309-50339331 AGAGAGAAGAAAAATGATATGGG + Intronic
1040792328 8:51246923-51246945 AGAAAGAAGAAAAATTATATAGG + Intergenic
1041093003 8:54320341-54320363 AGAGAGAAAGGAAATGATATAGG + Intergenic
1041212088 8:55562391-55562413 ACAGAGAAGGAAAATGATATAGG - Intergenic
1041305479 8:56453161-56453183 AGAGAGAAGGAAAATAATAAAGG + Intergenic
1041339430 8:56826769-56826791 AGAGAAAAGGAAAATAATATAGG + Intergenic
1042225064 8:66508694-66508716 AGGGAGTAGCAAACTGACTTTGG - Intronic
1043250862 8:78071412-78071434 AAAGAAAAGGAAAATGATATAGG + Intergenic
1044206973 8:89501922-89501944 AGTTACAAGCAAAATGCTATGGG - Intergenic
1044421938 8:92006630-92006652 AGAGTAAAGGAAAATGATATAGG - Intronic
1044748515 8:95394442-95394464 AAGGAGAAGCAAAGTGACAGCGG - Intergenic
1045131091 8:99153815-99153837 AGAGAGAAGAAAAATGATAAAGG - Intronic
1045155936 8:99471161-99471183 AGGATGAAGGAAAATGATACTGG + Intronic
1045198940 8:99959279-99959301 AGAGAGAAGGAAAATTATATAGG + Intergenic
1045996261 8:108365490-108365512 AGAGAGAAGGAAAATTACATAGG - Intronic
1046003818 8:108454708-108454730 AGAGAAAAGGAAAATAATATTGG - Intronic
1046170622 8:110500606-110500628 ACAGAGAAGGAAAATAATATAGG - Intergenic
1046188276 8:110752113-110752135 AGGAAGAAACATTATGATATAGG + Intergenic
1046406761 8:113783019-113783041 AGGCAGGAGAAAAATGTTATAGG + Intergenic
1046574094 8:116003705-116003727 AGAGAGAAGGAAAATTATATAGG + Intergenic
1046856799 8:119041379-119041401 ATTTAGTAGCAAAATGATATTGG + Intronic
1047554413 8:125913682-125913704 GTGGAGAACCAAAATGATATGGG + Intergenic
1047571764 8:126106538-126106560 AGAGAGAAATAAAATAATATGGG + Intergenic
1047577336 8:126171707-126171729 AGGTAGAAGCAAAGTGTTACAGG + Intergenic
1048134257 8:131731204-131731226 AGGAAGAAGGAAAATTACATAGG + Intergenic
1048596101 8:135868050-135868072 AGGAAGAAACAATATGATGTTGG - Intergenic
1049493866 8:142919715-142919737 AGAGAGAAAGAAAATGATACAGG - Intergenic
1050376827 9:4983117-4983139 AGGGAGAAGCCATTTGAAATTGG - Intergenic
1050828368 9:9979144-9979166 AGGCAGAAGGAATATGATATGGG + Intronic
1051630947 9:19140497-19140519 GGCGAGAAGCAAGATGATGTTGG - Intronic
1051657224 9:19394540-19394562 AGAGAGAAGGAAAATTATATAGG + Intergenic
1052079901 9:24191907-24191929 AGAGAGAAAGAAAATGATATAGG - Intergenic
1052477440 9:28978268-28978290 AGGGAGAAGAAAATTAATGTGGG - Intergenic
1052679370 9:31669279-31669301 AGGGAGAAGAAAGCTGACATAGG + Intergenic
1052781656 9:32787294-32787316 TGGGAGAAGAAACATGAAATAGG - Exonic
1053671342 9:40366809-40366831 AGGGAGAAGAAAAAGGGTATAGG + Intergenic
1053851526 9:42293536-42293558 AGGCAGAAGTAAAATTATAGTGG + Intergenic
1053921152 9:42993183-42993205 AGGGAGAAGAAAAATGGTATAGG + Intergenic
1054382454 9:64506859-64506881 AGGGAGAAGAAAAAGGGTATAGG + Intergenic
1054513274 9:66009501-66009523 AGGGAGAAGAAAAAGGGTATAGG - Intergenic
1054845565 9:69793261-69793283 AGAGAGCAGTAAAATAATATAGG - Intergenic
1055881209 9:81006089-81006111 AGGGAGAAGGGAAATGACACAGG + Intergenic
1056700699 9:88904167-88904189 AGGGAGAAGGAAAGTGATATAGG - Intergenic
1056871006 9:90278517-90278539 GGAAAGAAGAAAAATGATATAGG + Intergenic
1057136213 9:92689897-92689919 AGAGAGAAGGAAAATGATACAGG - Intergenic
1057461616 9:95268084-95268106 GGGGAGAGGCAAAATGCTAGTGG - Intronic
1058437640 9:104977770-104977792 AGAGAGAGGAAAAATGGTATAGG - Intergenic
1060016584 9:120091822-120091844 AGGGAGTAGGAACATGAGATAGG + Intergenic
1060069581 9:120534432-120534454 AGGGAGGAGCAGGATGATAAGGG - Intronic
1060233761 9:121845419-121845441 AGAGAACAGAAAAATGATATGGG + Intronic
1060576588 9:124701296-124701318 AGGGAGATGCAAATTAAAATTGG - Intronic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1185999255 X:4989537-4989559 AGGGAGAAGAAAAAAGAAGTAGG - Intergenic
1186822258 X:13302420-13302442 AGAGAGAAGGAAATTGATATAGG - Intergenic
1187643872 X:21325139-21325161 AGAAAGAAGAAAAATAATATAGG - Intergenic
1187833659 X:23408792-23408814 GGGGAGAGGCAAAGTGATACAGG + Intergenic
1188179957 X:27043063-27043085 GGAGAGAAGGAAAATTATATAGG - Intergenic
1188247094 X:27849308-27849330 ATGCAGAAGGAAACTGATATAGG - Intergenic
1188326849 X:28815162-28815184 AGGCAGAGGTAAAATAATATAGG - Intronic
1189157839 X:38777761-38777783 AGTGAGAAGCAAGATGAGACTGG + Intergenic
1189584673 X:42446374-42446396 AGGCAGAAGAAAAAGTATATAGG + Intergenic
1189854718 X:45212527-45212549 AGGAACAAGCAAACAGATATAGG - Intergenic
1189934056 X:46046630-46046652 AGAGAGAAGGAAAACAATATAGG + Intergenic
1190132910 X:47767963-47767985 AGTGGGAAGCAATATGCTATAGG - Intergenic
1190139031 X:47825028-47825050 AGGGAGAAGGAAAATAATCTAGG + Intergenic
1190335473 X:49259163-49259185 AGGGAGAGTCAAAGTGACATGGG + Intronic
1190579595 X:51879277-51879299 GGGCAGAAAGAAAATGATATAGG - Intronic
1190586763 X:51952195-51952217 AGAGAGAAGGAAAATGATAAAGG + Intergenic
1191976238 X:66874708-66874730 AGGGAGAAGCAAGGTGAGATTGG + Intergenic
1191990798 X:67033685-67033707 AGGGAGAAGTCAAATTATCTTGG - Intergenic
1192208167 X:69109787-69109809 AGGGAGAGAGAAAATGATTTAGG + Intergenic
1192208486 X:69111411-69111433 AGGAAGAAACAAAAGGATGTGGG + Intergenic
1192217414 X:69171782-69171804 AGAGAGAAGAAAAATAATACTGG - Intergenic
1192347935 X:70327367-70327389 AGGGAGAAGCTAAAGGATCAGGG + Intronic
1192381090 X:70617261-70617283 AGAGAGAAGGAAAATGATATAGG + Intronic
1192862363 X:75089200-75089222 AGAGAGAATGCAAATGATATTGG + Intronic
1193552000 X:82905356-82905378 AGGGAGCAGGATAATTATATAGG - Intergenic
1194162769 X:90474936-90474958 AGGAGGAAGCAAAATTGTATTGG + Intergenic
1194287823 X:92032427-92032449 AGGAAGAAGTAAAATTATCTTGG - Intronic
1194559949 X:95407882-95407904 AGAGTAAAGCAAAATGAAATTGG - Intergenic
1194864262 X:99047144-99047166 AGAGAGAAGGAACATGATATTGG - Intergenic
1195207308 X:102615135-102615157 AGAGAGAAGGAAAATTATACAGG - Intergenic
1195633242 X:107083028-107083050 AGAGATAAGCAAAATTATATAGG - Intronic
1195694352 X:107655690-107655712 AGGGAAGAACAAAATGCTATGGG + Intergenic
1196241606 X:113348418-113348440 AGGGAGAAACAATATGCCATAGG - Intergenic
1196263488 X:113613764-113613786 AGGCAGAAAGAAAATGACATAGG - Intergenic
1196298741 X:114030192-114030214 ACTGAGAAGAAAAAGGATATAGG + Intergenic
1196313026 X:114190506-114190528 AGAGAGAAAGAAAATGATGTAGG + Intergenic
1196322758 X:114361892-114361914 AGTGAGAAACAATATTATATTGG + Intergenic
1196698757 X:118643152-118643174 ATTGAGAAGCAATATGGTATAGG + Intronic
1196795499 X:119499181-119499203 AGAGAGAACCCAAATGATAAAGG + Intergenic
1197030937 X:121814855-121814877 AGGGAAAACAAAAATGTTATAGG - Intergenic
1197071730 X:122306806-122306828 AGAGAGAAAGAAAATGATATAGG - Intergenic
1197101349 X:122659463-122659485 AGGCAGAGGCAAAAAGGTATTGG - Intergenic
1197144053 X:123151147-123151169 AGGGGACTGCAAAATGATATGGG + Intergenic
1198102113 X:133431165-133431187 AGGGAGGAATAAACTGATATAGG + Intergenic
1199293036 X:146126343-146126365 AGAGAGAAGGAAAGTAATATAGG - Intergenic
1199426862 X:147712523-147712545 GGGGAAAAGCAACATAATATTGG - Intergenic
1199550234 X:149053342-149053364 ACACAGAAGCCAAATGATATTGG - Intergenic
1200371904 X:155736308-155736330 AGGGAGAAGGAAAATGATATAGG - Intergenic
1200509045 Y:4052672-4052694 AGGAGGAAGCAAAATTGTATTGG + Intergenic
1200605351 Y:5256986-5257008 AGGAAGAAGTAAAATTATCTTGG - Intronic
1201720966 Y:17096598-17096620 AGAAAGAAACAAAATGACATTGG + Intergenic