ID: 1002817447

View in Genome Browser
Species Human (GRCh38)
Location 6:693559-693581
Sequence TCGGTGCAGCCCCCCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002817447_1002817456 30 Left 1002817447 6:693559-693581 CCAGGTCAGGGGGGCTGCACCGA No data
Right 1002817456 6:693612-693634 CACTGGAGTGTGCATCCCCAGGG No data
1002817447_1002817451 1 Left 1002817447 6:693559-693581 CCAGGTCAGGGGGGCTGCACCGA No data
Right 1002817451 6:693583-693605 ACCAGAGGAAGCATCAGGTCAGG No data
1002817447_1002817453 4 Left 1002817447 6:693559-693581 CCAGGTCAGGGGGGCTGCACCGA No data
Right 1002817453 6:693586-693608 AGAGGAAGCATCAGGTCAGGAGG No data
1002817447_1002817454 13 Left 1002817447 6:693559-693581 CCAGGTCAGGGGGGCTGCACCGA No data
Right 1002817454 6:693595-693617 ATCAGGTCAGGAGGATGCACTGG No data
1002817447_1002817450 -4 Left 1002817447 6:693559-693581 CCAGGTCAGGGGGGCTGCACCGA No data
Right 1002817450 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
1002817447_1002817455 29 Left 1002817447 6:693559-693581 CCAGGTCAGGGGGGCTGCACCGA No data
Right 1002817455 6:693611-693633 GCACTGGAGTGTGCATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002817447 Original CRISPR TCGGTGCAGCCCCCCTGACC TGG (reversed) Intergenic