ID: 1002817449

View in Genome Browser
Species Human (GRCh38)
Location 6:693578-693600
Sequence CCTGATGCTTCCTCTGGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002817449_1002817458 13 Left 1002817449 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
Right 1002817458 6:693614-693636 CTGGAGTGTGCATCCCCAGGGGG No data
1002817449_1002817460 23 Left 1002817449 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
Right 1002817460 6:693624-693646 CATCCCCAGGGGGCCACACTGGG No data
1002817449_1002817464 28 Left 1002817449 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
Right 1002817464 6:693629-693651 CCAGGGGGCCACACTGGGTAAGG No data
1002817449_1002817455 10 Left 1002817449 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
Right 1002817455 6:693611-693633 GCACTGGAGTGTGCATCCCCAGG No data
1002817449_1002817459 22 Left 1002817449 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
Right 1002817459 6:693623-693645 GCATCCCCAGGGGGCCACACTGG No data
1002817449_1002817457 12 Left 1002817449 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
Right 1002817457 6:693613-693635 ACTGGAGTGTGCATCCCCAGGGG No data
1002817449_1002817456 11 Left 1002817449 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
Right 1002817456 6:693612-693634 CACTGGAGTGTGCATCCCCAGGG No data
1002817449_1002817454 -6 Left 1002817449 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
Right 1002817454 6:693595-693617 ATCAGGTCAGGAGGATGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002817449 Original CRISPR CCTGATGCTTCCTCTGGTCT CGG (reversed) Intergenic