ID: 1002817452

View in Genome Browser
Species Human (GRCh38)
Location 6:693584-693606
Sequence TCCTGACCTGATGCTTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002817452_1002817456 5 Left 1002817452 6:693584-693606 CCAGAGGAAGCATCAGGTCAGGA No data
Right 1002817456 6:693612-693634 CACTGGAGTGTGCATCCCCAGGG No data
1002817452_1002817465 25 Left 1002817452 6:693584-693606 CCAGAGGAAGCATCAGGTCAGGA No data
Right 1002817465 6:693632-693654 GGGGGCCACACTGGGTAAGGAGG No data
1002817452_1002817455 4 Left 1002817452 6:693584-693606 CCAGAGGAAGCATCAGGTCAGGA No data
Right 1002817455 6:693611-693633 GCACTGGAGTGTGCATCCCCAGG No data
1002817452_1002817458 7 Left 1002817452 6:693584-693606 CCAGAGGAAGCATCAGGTCAGGA No data
Right 1002817458 6:693614-693636 CTGGAGTGTGCATCCCCAGGGGG No data
1002817452_1002817459 16 Left 1002817452 6:693584-693606 CCAGAGGAAGCATCAGGTCAGGA No data
Right 1002817459 6:693623-693645 GCATCCCCAGGGGGCCACACTGG No data
1002817452_1002817464 22 Left 1002817452 6:693584-693606 CCAGAGGAAGCATCAGGTCAGGA No data
Right 1002817464 6:693629-693651 CCAGGGGGCCACACTGGGTAAGG No data
1002817452_1002817460 17 Left 1002817452 6:693584-693606 CCAGAGGAAGCATCAGGTCAGGA No data
Right 1002817460 6:693624-693646 CATCCCCAGGGGGCCACACTGGG No data
1002817452_1002817457 6 Left 1002817452 6:693584-693606 CCAGAGGAAGCATCAGGTCAGGA No data
Right 1002817457 6:693613-693635 ACTGGAGTGTGCATCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002817452 Original CRISPR TCCTGACCTGATGCTTCCTC TGG (reversed) Intergenic