ID: 1002817456

View in Genome Browser
Species Human (GRCh38)
Location 6:693612-693634
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002817449_1002817456 11 Left 1002817449 6:693578-693600 CCGAGACCAGAGGAAGCATCAGG No data
Right 1002817456 6:693612-693634 CACTGGAGTGTGCATCCCCAGGG No data
1002817447_1002817456 30 Left 1002817447 6:693559-693581 CCAGGTCAGGGGGGCTGCACCGA No data
Right 1002817456 6:693612-693634 CACTGGAGTGTGCATCCCCAGGG No data
1002817452_1002817456 5 Left 1002817452 6:693584-693606 CCAGAGGAAGCATCAGGTCAGGA No data
Right 1002817456 6:693612-693634 CACTGGAGTGTGCATCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002817456 Original CRISPR CACTGGAGTGTGCATCCCCA GGG Intergenic
No off target data available for this crispr