ID: 1002820873

View in Genome Browser
Species Human (GRCh38)
Location 6:723532-723554
Sequence CTCTGGGCATGGAGAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002820865_1002820873 15 Left 1002820865 6:723494-723516 CCATGTTAAACGTGTAATGCCTG No data
Right 1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG No data
1002820867_1002820873 -4 Left 1002820867 6:723513-723535 CCTGTCAACTGAATAGGACCTCT No data
Right 1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002820873 Original CRISPR CTCTGGGCATGGAGAGAGGA TGG Intergenic
No off target data available for this crispr