ID: 1002829312

View in Genome Browser
Species Human (GRCh38)
Location 6:804803-804825
Sequence CTGTTAACAAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002829312_1002829320 19 Left 1002829312 6:804803-804825 CCTTCCTCCTTCTTTGTTAACAG No data
Right 1002829320 6:804845-804867 AGGCAGCATGCCTGGCACCAAGG No data
1002829312_1002829315 -6 Left 1002829312 6:804803-804825 CCTTCCTCCTTCTTTGTTAACAG No data
Right 1002829315 6:804820-804842 TAACAGAAGTGAACCGTCACAGG No data
1002829312_1002829317 -1 Left 1002829312 6:804803-804825 CCTTCCTCCTTCTTTGTTAACAG No data
Right 1002829317 6:804825-804847 GAAGTGAACCGTCACAGGGAAGG No data
1002829312_1002829316 -5 Left 1002829312 6:804803-804825 CCTTCCTCCTTCTTTGTTAACAG No data
Right 1002829316 6:804821-804843 AACAGAAGTGAACCGTCACAGGG No data
1002829312_1002829319 11 Left 1002829312 6:804803-804825 CCTTCCTCCTTCTTTGTTAACAG No data
Right 1002829319 6:804837-804859 CACAGGGAAGGCAGCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002829312 Original CRISPR CTGTTAACAAAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr