ID: 1002831615

View in Genome Browser
Species Human (GRCh38)
Location 6:826961-826983
Sequence AAGGCCTAAGAACTTTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002831615_1002831622 16 Left 1002831615 6:826961-826983 CCCTGAGAAAGTTCTTAGGCCTT No data
Right 1002831622 6:827000-827022 GTAGAGTGGTTGGAACATGTGGG No data
1002831615_1002831617 -8 Left 1002831615 6:826961-826983 CCCTGAGAAAGTTCTTAGGCCTT No data
Right 1002831617 6:826976-826998 TAGGCCTTAGTGAAGTTTCTAGG No data
1002831615_1002831620 6 Left 1002831615 6:826961-826983 CCCTGAGAAAGTTCTTAGGCCTT No data
Right 1002831620 6:826990-827012 GTTTCTAGGAGTAGAGTGGTTGG No data
1002831615_1002831619 2 Left 1002831615 6:826961-826983 CCCTGAGAAAGTTCTTAGGCCTT No data
Right 1002831619 6:826986-827008 TGAAGTTTCTAGGAGTAGAGTGG No data
1002831615_1002831621 15 Left 1002831615 6:826961-826983 CCCTGAGAAAGTTCTTAGGCCTT No data
Right 1002831621 6:826999-827021 AGTAGAGTGGTTGGAACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002831615 Original CRISPR AAGGCCTAAGAACTTTCTCA GGG (reversed) Intergenic
No off target data available for this crispr