ID: 1002831616

View in Genome Browser
Species Human (GRCh38)
Location 6:826962-826984
Sequence TAAGGCCTAAGAACTTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002831616_1002831619 1 Left 1002831616 6:826962-826984 CCTGAGAAAGTTCTTAGGCCTTA No data
Right 1002831619 6:826986-827008 TGAAGTTTCTAGGAGTAGAGTGG No data
1002831616_1002831617 -9 Left 1002831616 6:826962-826984 CCTGAGAAAGTTCTTAGGCCTTA No data
Right 1002831617 6:826976-826998 TAGGCCTTAGTGAAGTTTCTAGG No data
1002831616_1002831620 5 Left 1002831616 6:826962-826984 CCTGAGAAAGTTCTTAGGCCTTA No data
Right 1002831620 6:826990-827012 GTTTCTAGGAGTAGAGTGGTTGG No data
1002831616_1002831621 14 Left 1002831616 6:826962-826984 CCTGAGAAAGTTCTTAGGCCTTA No data
Right 1002831621 6:826999-827021 AGTAGAGTGGTTGGAACATGTGG No data
1002831616_1002831622 15 Left 1002831616 6:826962-826984 CCTGAGAAAGTTCTTAGGCCTTA No data
Right 1002831622 6:827000-827022 GTAGAGTGGTTGGAACATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002831616 Original CRISPR TAAGGCCTAAGAACTTTCTC AGG (reversed) Intergenic
No off target data available for this crispr