ID: 1002831617

View in Genome Browser
Species Human (GRCh38)
Location 6:826976-826998
Sequence TAGGCCTTAGTGAAGTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002831610_1002831617 28 Left 1002831610 6:826925-826947 CCAGAAGCTTTTGTAAAACAGAG No data
Right 1002831617 6:826976-826998 TAGGCCTTAGTGAAGTTTCTAGG No data
1002831616_1002831617 -9 Left 1002831616 6:826962-826984 CCTGAGAAAGTTCTTAGGCCTTA No data
Right 1002831617 6:826976-826998 TAGGCCTTAGTGAAGTTTCTAGG No data
1002831609_1002831617 29 Left 1002831609 6:826924-826946 CCCAGAAGCTTTTGTAAAACAGA No data
Right 1002831617 6:826976-826998 TAGGCCTTAGTGAAGTTTCTAGG No data
1002831615_1002831617 -8 Left 1002831615 6:826961-826983 CCCTGAGAAAGTTCTTAGGCCTT No data
Right 1002831617 6:826976-826998 TAGGCCTTAGTGAAGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002831617 Original CRISPR TAGGCCTTAGTGAAGTTTCT AGG Intergenic
No off target data available for this crispr