ID: 1002831618

View in Genome Browser
Species Human (GRCh38)
Location 6:826980-827002
Sequence TACTCCTAGAAACTTCACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002831618_1002831622 -3 Left 1002831618 6:826980-827002 CCTTAGTGAAGTTTCTAGGAGTA No data
Right 1002831622 6:827000-827022 GTAGAGTGGTTGGAACATGTGGG No data
1002831618_1002831621 -4 Left 1002831618 6:826980-827002 CCTTAGTGAAGTTTCTAGGAGTA No data
Right 1002831621 6:826999-827021 AGTAGAGTGGTTGGAACATGTGG No data
1002831618_1002831626 28 Left 1002831618 6:826980-827002 CCTTAGTGAAGTTTCTAGGAGTA No data
Right 1002831626 6:827031-827053 ATTAAAGTGGGAGAGAAGATTGG No data
1002831618_1002831624 16 Left 1002831618 6:826980-827002 CCTTAGTGAAGTTTCTAGGAGTA No data
Right 1002831624 6:827019-827041 TGGGATATTTCCATTAAAGTGGG No data
1002831618_1002831623 15 Left 1002831618 6:826980-827002 CCTTAGTGAAGTTTCTAGGAGTA No data
Right 1002831623 6:827018-827040 GTGGGATATTTCCATTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002831618 Original CRISPR TACTCCTAGAAACTTCACTA AGG (reversed) Intergenic
No off target data available for this crispr