ID: 1002831621

View in Genome Browser
Species Human (GRCh38)
Location 6:826999-827021
Sequence AGTAGAGTGGTTGGAACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002831616_1002831621 14 Left 1002831616 6:826962-826984 CCTGAGAAAGTTCTTAGGCCTTA No data
Right 1002831621 6:826999-827021 AGTAGAGTGGTTGGAACATGTGG No data
1002831618_1002831621 -4 Left 1002831618 6:826980-827002 CCTTAGTGAAGTTTCTAGGAGTA No data
Right 1002831621 6:826999-827021 AGTAGAGTGGTTGGAACATGTGG No data
1002831615_1002831621 15 Left 1002831615 6:826961-826983 CCCTGAGAAAGTTCTTAGGCCTT No data
Right 1002831621 6:826999-827021 AGTAGAGTGGTTGGAACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002831621 Original CRISPR AGTAGAGTGGTTGGAACATG TGG Intergenic
No off target data available for this crispr