ID: 1002831622

View in Genome Browser
Species Human (GRCh38)
Location 6:827000-827022
Sequence GTAGAGTGGTTGGAACATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002831616_1002831622 15 Left 1002831616 6:826962-826984 CCTGAGAAAGTTCTTAGGCCTTA No data
Right 1002831622 6:827000-827022 GTAGAGTGGTTGGAACATGTGGG No data
1002831615_1002831622 16 Left 1002831615 6:826961-826983 CCCTGAGAAAGTTCTTAGGCCTT No data
Right 1002831622 6:827000-827022 GTAGAGTGGTTGGAACATGTGGG No data
1002831618_1002831622 -3 Left 1002831618 6:826980-827002 CCTTAGTGAAGTTTCTAGGAGTA No data
Right 1002831622 6:827000-827022 GTAGAGTGGTTGGAACATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002831622 Original CRISPR GTAGAGTGGTTGGAACATGT GGG Intergenic
No off target data available for this crispr