ID: 1002831624

View in Genome Browser
Species Human (GRCh38)
Location 6:827019-827041
Sequence TGGGATATTTCCATTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002831618_1002831624 16 Left 1002831618 6:826980-827002 CCTTAGTGAAGTTTCTAGGAGTA No data
Right 1002831624 6:827019-827041 TGGGATATTTCCATTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002831624 Original CRISPR TGGGATATTTCCATTAAAGT GGG Intergenic
No off target data available for this crispr