ID: 1002831626

View in Genome Browser
Species Human (GRCh38)
Location 6:827031-827053
Sequence ATTAAAGTGGGAGAGAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002831618_1002831626 28 Left 1002831618 6:826980-827002 CCTTAGTGAAGTTTCTAGGAGTA No data
Right 1002831626 6:827031-827053 ATTAAAGTGGGAGAGAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002831626 Original CRISPR ATTAAAGTGGGAGAGAAGAT TGG Intergenic
No off target data available for this crispr