ID: 1002831664

View in Genome Browser
Species Human (GRCh38)
Location 6:827288-827310
Sequence CACGCTTCTCCCCTTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002831664_1002831667 -7 Left 1002831664 6:827288-827310 CCTGATTCAAGGGGAGAAGCGTG No data
Right 1002831667 6:827304-827326 AAGCGTGGGCGTTTTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002831664 Original CRISPR CACGCTTCTCCCCTTGAATC AGG (reversed) Intergenic
No off target data available for this crispr