ID: 1002832622

View in Genome Browser
Species Human (GRCh38)
Location 6:836627-836649
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002832610_1002832622 11 Left 1002832610 6:836593-836615 CCACACTGAGGAAAGGAAGCATT No data
Right 1002832622 6:836627-836649 CATGGGGCCCACGCTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002832622 Original CRISPR CATGGGGCCCACGCTGGGTG GGG Intergenic
No off target data available for this crispr