ID: 1002835255

View in Genome Browser
Species Human (GRCh38)
Location 6:860311-860333
Sequence GTCCACACCTTGGCAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002835251_1002835255 14 Left 1002835251 6:860274-860296 CCACAATGCTGTTATTTGCAGGA No data
Right 1002835255 6:860311-860333 GTCCACACCTTGGCAGAACCAGG No data
1002835249_1002835255 21 Left 1002835249 6:860267-860289 CCATCTACCACAATGCTGTTATT No data
Right 1002835255 6:860311-860333 GTCCACACCTTGGCAGAACCAGG No data
1002835248_1002835255 22 Left 1002835248 6:860266-860288 CCCATCTACCACAATGCTGTTAT No data
Right 1002835255 6:860311-860333 GTCCACACCTTGGCAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002835255 Original CRISPR GTCCACACCTTGGCAGAACC AGG Intergenic
No off target data available for this crispr