ID: 1002837213

View in Genome Browser
Species Human (GRCh38)
Location 6:875020-875042
Sequence TGTTATTTTTAGAAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002837206_1002837213 14 Left 1002837206 6:874983-875005 CCTGAGCCTGCAGCTGGAAGGAA No data
Right 1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG No data
1002837204_1002837213 19 Left 1002837204 6:874978-875000 CCTGTCCTGAGCCTGCAGCTGGA No data
Right 1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG No data
1002837207_1002837213 8 Left 1002837207 6:874989-875011 CCTGCAGCTGGAAGGAAGAGTGG No data
Right 1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG No data
1002837202_1002837213 20 Left 1002837202 6:874977-874999 CCCTGTCCTGAGCCTGCAGCTGG No data
Right 1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002837213 Original CRISPR TGTTATTTTTAGAAGATGGA GGG Intergenic
No off target data available for this crispr