ID: 1002837237

View in Genome Browser
Species Human (GRCh38)
Location 6:875147-875169
Sequence CACCTTTTCTAGAGTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002837237_1002837241 -10 Left 1002837237 6:875147-875169 CCCACTGCACTCTAGAAAAGGTG No data
Right 1002837241 6:875160-875182 AGAAAAGGTGATCTGGCGGACGG No data
1002837237_1002837243 15 Left 1002837237 6:875147-875169 CCCACTGCACTCTAGAAAAGGTG No data
Right 1002837243 6:875185-875207 GCTTGCTACGTTGCCTTTTCTGG No data
1002837237_1002837242 -7 Left 1002837237 6:875147-875169 CCCACTGCACTCTAGAAAAGGTG No data
Right 1002837242 6:875163-875185 AAAGGTGATCTGGCGGACGGTGG No data
1002837237_1002837244 16 Left 1002837237 6:875147-875169 CCCACTGCACTCTAGAAAAGGTG No data
Right 1002837244 6:875186-875208 CTTGCTACGTTGCCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002837237 Original CRISPR CACCTTTTCTAGAGTGCAGT GGG (reversed) Intergenic
No off target data available for this crispr