ID: 1002837375

View in Genome Browser
Species Human (GRCh38)
Location 6:876352-876374
Sequence CCTGACCCTCTCCCAGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002837365_1002837375 -10 Left 1002837365 6:876339-876361 CCCTTCCGCCCACCCTGACCCTC No data
Right 1002837375 6:876352-876374 CCTGACCCTCTCCCAGGGATGGG No data
1002837364_1002837375 -5 Left 1002837364 6:876334-876356 CCTGACCCTTCCGCCCACCCTGA No data
Right 1002837375 6:876352-876374 CCTGACCCTCTCCCAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002837375 Original CRISPR CCTGACCCTCTCCCAGGGAT GGG Intergenic
No off target data available for this crispr