ID: 1002837976

View in Genome Browser
Species Human (GRCh38)
Location 6:881363-881385
Sequence TGCCACTCCAGAATTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002837976_1002837978 -4 Left 1002837976 6:881363-881385 CCCTGCTCAATTCTGGAGTGGCA No data
Right 1002837978 6:881382-881404 GGCAGCAGCCACAGTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002837976 Original CRISPR TGCCACTCCAGAATTGAGCA GGG (reversed) Intergenic
No off target data available for this crispr