ID: 1002845485

View in Genome Browser
Species Human (GRCh38)
Location 6:940866-940888
Sequence CTGCTTCTCGTGAGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002845475_1002845485 25 Left 1002845475 6:940818-940840 CCTGGACAGGAAGACGAGAGCCA No data
Right 1002845485 6:940866-940888 CTGCTTCTCGTGAGGAAAACAGG No data
1002845477_1002845485 5 Left 1002845477 6:940838-940860 CCAGGCCCAGCTGCTCTACCTCC No data
Right 1002845485 6:940866-940888 CTGCTTCTCGTGAGGAAAACAGG No data
1002845479_1002845485 0 Left 1002845479 6:940843-940865 CCCAGCTGCTCTACCTCCCAGGA No data
Right 1002845485 6:940866-940888 CTGCTTCTCGTGAGGAAAACAGG No data
1002845480_1002845485 -1 Left 1002845480 6:940844-940866 CCAGCTGCTCTACCTCCCAGGAC No data
Right 1002845485 6:940866-940888 CTGCTTCTCGTGAGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002845485 Original CRISPR CTGCTTCTCGTGAGGAAAAC AGG Intergenic
No off target data available for this crispr