ID: 1002846625

View in Genome Browser
Species Human (GRCh38)
Location 6:951806-951828
Sequence ATAATCAGACTTTTTTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002846622_1002846625 -8 Left 1002846622 6:951791-951813 CCACCGATAATAAAAATAATCAG No data
Right 1002846625 6:951806-951828 ATAATCAGACTTTTTTAAGGTGG No data
1002846620_1002846625 12 Left 1002846620 6:951771-951793 CCTTCTAATGTAGCCTGGCGCCA No data
Right 1002846625 6:951806-951828 ATAATCAGACTTTTTTAAGGTGG No data
1002846621_1002846625 -1 Left 1002846621 6:951784-951806 CCTGGCGCCACCGATAATAAAAA No data
Right 1002846625 6:951806-951828 ATAATCAGACTTTTTTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002846625 Original CRISPR ATAATCAGACTTTTTTAAGG TGG Intergenic