ID: 1002848002

View in Genome Browser
Species Human (GRCh38)
Location 6:965976-965998
Sequence CGGGTAGTTACAGCCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002848002_1002848009 18 Left 1002848002 6:965976-965998 CCCTGTGAGGCTGTAACTACCCG No data
Right 1002848009 6:966017-966039 CAAGACTGTAGCTACCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002848002 Original CRISPR CGGGTAGTTACAGCCTCACA GGG (reversed) Intergenic
No off target data available for this crispr