ID: 1002848570

View in Genome Browser
Species Human (GRCh38)
Location 6:970492-970514
Sequence TACCTCCCAATGTTGTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002848568_1002848570 13 Left 1002848568 6:970456-970478 CCTTTGGAATTTTGAAAGTATTA No data
Right 1002848570 6:970492-970514 TACCTCCCAATGTTGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002848570 Original CRISPR TACCTCCCAATGTTGTTGCT GGG Intergenic
No off target data available for this crispr