ID: 1002853355

View in Genome Browser
Species Human (GRCh38)
Location 6:1016184-1016206
Sequence TTATAGATCTTCAGGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002853355_1002853367 17 Left 1002853355 6:1016184-1016206 CCCTCCCACCTGAAGATCTATAA No data
Right 1002853367 6:1016224-1016246 CAGGGGACACATTGAAATATGGG No data
1002853355_1002853360 -2 Left 1002853355 6:1016184-1016206 CCCTCCCACCTGAAGATCTATAA No data
Right 1002853360 6:1016205-1016227 AACTGTGACATCCCAAGTCCAGG No data
1002853355_1002853361 -1 Left 1002853355 6:1016184-1016206 CCCTCCCACCTGAAGATCTATAA No data
Right 1002853361 6:1016206-1016228 ACTGTGACATCCCAAGTCCAGGG No data
1002853355_1002853366 16 Left 1002853355 6:1016184-1016206 CCCTCCCACCTGAAGATCTATAA No data
Right 1002853366 6:1016223-1016245 CCAGGGGACACATTGAAATATGG No data
1002853355_1002853362 0 Left 1002853355 6:1016184-1016206 CCCTCCCACCTGAAGATCTATAA No data
Right 1002853362 6:1016207-1016229 CTGTGACATCCCAAGTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002853355 Original CRISPR TTATAGATCTTCAGGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr