ID: 1002858157

View in Genome Browser
Species Human (GRCh38)
Location 6:1056276-1056298
Sequence CTTTCTAACTGGCCCGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002858157_1002858165 28 Left 1002858157 6:1056276-1056298 CCTCACTCGGGCCAGTTAGAAAG No data
Right 1002858165 6:1056327-1056349 CCACAGCCGGCCGGACGAGGTGG No data
1002858157_1002858160 -7 Left 1002858157 6:1056276-1056298 CCTCACTCGGGCCAGTTAGAAAG No data
Right 1002858160 6:1056292-1056314 TAGAAAGTCAGTGGCACATCTGG No data
1002858157_1002858162 19 Left 1002858157 6:1056276-1056298 CCTCACTCGGGCCAGTTAGAAAG No data
Right 1002858162 6:1056318-1056340 CAGAAGACTCCACAGCCGGCCGG No data
1002858157_1002858161 15 Left 1002858157 6:1056276-1056298 CCTCACTCGGGCCAGTTAGAAAG No data
Right 1002858161 6:1056314-1056336 GAAGCAGAAGACTCCACAGCCGG No data
1002858157_1002858163 25 Left 1002858157 6:1056276-1056298 CCTCACTCGGGCCAGTTAGAAAG No data
Right 1002858163 6:1056324-1056346 ACTCCACAGCCGGCCGGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002858157 Original CRISPR CTTTCTAACTGGCCCGAGTG AGG (reversed) Intergenic