ID: 1002858159

View in Genome Browser
Species Human (GRCh38)
Location 6:1056287-1056309
Sequence TGTGCCACTGACTTTCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002858159_1002858162 8 Left 1002858159 6:1056287-1056309 CCAGTTAGAAAGTCAGTGGCACA No data
Right 1002858162 6:1056318-1056340 CAGAAGACTCCACAGCCGGCCGG No data
1002858159_1002858165 17 Left 1002858159 6:1056287-1056309 CCAGTTAGAAAGTCAGTGGCACA No data
Right 1002858165 6:1056327-1056349 CCACAGCCGGCCGGACGAGGTGG No data
1002858159_1002858163 14 Left 1002858159 6:1056287-1056309 CCAGTTAGAAAGTCAGTGGCACA No data
Right 1002858163 6:1056324-1056346 ACTCCACAGCCGGCCGGACGAGG No data
1002858159_1002858161 4 Left 1002858159 6:1056287-1056309 CCAGTTAGAAAGTCAGTGGCACA No data
Right 1002858161 6:1056314-1056336 GAAGCAGAAGACTCCACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002858159 Original CRISPR TGTGCCACTGACTTTCTAAC TGG (reversed) Intergenic