ID: 1002858161

View in Genome Browser
Species Human (GRCh38)
Location 6:1056314-1056336
Sequence GAAGCAGAAGACTCCACAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002858157_1002858161 15 Left 1002858157 6:1056276-1056298 CCTCACTCGGGCCAGTTAGAAAG No data
Right 1002858161 6:1056314-1056336 GAAGCAGAAGACTCCACAGCCGG No data
1002858159_1002858161 4 Left 1002858159 6:1056287-1056309 CCAGTTAGAAAGTCAGTGGCACA No data
Right 1002858161 6:1056314-1056336 GAAGCAGAAGACTCCACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002858161 Original CRISPR GAAGCAGAAGACTCCACAGC CGG Intergenic
No off target data available for this crispr