ID: 1002864930

View in Genome Browser
Species Human (GRCh38)
Location 6:1113015-1113037
Sequence TTATTGCCAAGGCCAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002864930_1002864934 25 Left 1002864930 6:1113015-1113037 CCTGACTTTGGCCTTGGCAATAA No data
Right 1002864934 6:1113063-1113085 CAGGCAACAAAAGCAAAGATAGG 0: 2
1: 46
2: 161
3: 281
4: 942
1002864930_1002864932 6 Left 1002864930 6:1113015-1113037 CCTGACTTTGGCCTTGGCAATAA No data
Right 1002864932 6:1113044-1113066 AAGTATGACCACGAAAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002864930 Original CRISPR TTATTGCCAAGGCCAAAGTC AGG (reversed) Intergenic
No off target data available for this crispr