ID: 1002866311

View in Genome Browser
Species Human (GRCh38)
Location 6:1125278-1125300
Sequence CCTTCTGGACTGAGGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002866311_1002866320 20 Left 1002866311 6:1125278-1125300 CCACCTACCCTCAGTCCAGAAGG No data
Right 1002866320 6:1125321-1125343 TGTAAGGGACCCAATACACCTGG No data
1002866311_1002866318 4 Left 1002866311 6:1125278-1125300 CCACCTACCCTCAGTCCAGAAGG No data
Right 1002866318 6:1125305-1125327 TCATTGTCATATAGAATGTAAGG No data
1002866311_1002866319 5 Left 1002866311 6:1125278-1125300 CCACCTACCCTCAGTCCAGAAGG No data
Right 1002866319 6:1125306-1125328 CATTGTCATATAGAATGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002866311 Original CRISPR CCTTCTGGACTGAGGGTAGG TGG (reversed) Intergenic
No off target data available for this crispr