ID: 1002872881

View in Genome Browser
Species Human (GRCh38)
Location 6:1183275-1183297
Sequence CAGGAAGATACCTACTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002872878_1002872881 5 Left 1002872878 6:1183247-1183269 CCAATGTGAAACTACCGGTCGAG No data
Right 1002872881 6:1183275-1183297 CAGGAAGATACCTACTGTGTTGG No data
1002872876_1002872881 23 Left 1002872876 6:1183229-1183251 CCAACAGAGGAATTCTGACCAAT No data
Right 1002872881 6:1183275-1183297 CAGGAAGATACCTACTGTGTTGG No data
1002872880_1002872881 -9 Left 1002872880 6:1183261-1183283 CCGGTCGAGAAACTCAGGAAGAT No data
Right 1002872881 6:1183275-1183297 CAGGAAGATACCTACTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002872881 Original CRISPR CAGGAAGATACCTACTGTGT TGG Intergenic
No off target data available for this crispr