ID: 1002873741

View in Genome Browser
Species Human (GRCh38)
Location 6:1191249-1191271
Sequence CAGGCTGCCATGTAGGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002873725_1002873741 24 Left 1002873725 6:1191202-1191224 CCGGCCATGCCTGCCAGTGTCCA No data
Right 1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG No data
1002873724_1002873741 25 Left 1002873724 6:1191201-1191223 CCCGGCCATGCCTGCCAGTGTCC No data
Right 1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG No data
1002873726_1002873741 20 Left 1002873726 6:1191206-1191228 CCATGCCTGCCAGTGTCCAGAGA No data
Right 1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG No data
1002873727_1002873741 15 Left 1002873727 6:1191211-1191233 CCTGCCAGTGTCCAGAGACACTG No data
Right 1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG No data
1002873728_1002873741 11 Left 1002873728 6:1191215-1191237 CCAGTGTCCAGAGACACTGAGAG No data
Right 1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG No data
1002873731_1002873741 4 Left 1002873731 6:1191222-1191244 CCAGAGACACTGAGAGGGCCTGG No data
Right 1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002873741 Original CRISPR CAGGCTGCCATGTAGGGCCG GGG Intergenic
No off target data available for this crispr