ID: 1002873844

View in Genome Browser
Species Human (GRCh38)
Location 6:1192600-1192622
Sequence TAATCTTCCTGGAGGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002873840_1002873844 4 Left 1002873840 6:1192573-1192595 CCTTATTGGTATAAGTACACTTT No data
Right 1002873844 6:1192600-1192622 TAATCTTCCTGGAGGGCAGTTGG No data
1002873839_1002873844 8 Left 1002873839 6:1192569-1192591 CCTACCTTATTGGTATAAGTACA No data
Right 1002873844 6:1192600-1192622 TAATCTTCCTGGAGGGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002873844 Original CRISPR TAATCTTCCTGGAGGGCAGT TGG Intergenic
No off target data available for this crispr