ID: 1002877977

View in Genome Browser
Species Human (GRCh38)
Location 6:1227821-1227843
Sequence CTTTTTAGGAAATCGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002877977_1002877984 20 Left 1002877977 6:1227821-1227843 CCTGCCACCGATTTCCTAAAAAG No data
Right 1002877984 6:1227864-1227886 TTACTCTATAGATTTGCATGGGG No data
1002877977_1002877983 19 Left 1002877977 6:1227821-1227843 CCTGCCACCGATTTCCTAAAAAG No data
Right 1002877983 6:1227863-1227885 CTTACTCTATAGATTTGCATGGG No data
1002877977_1002877982 18 Left 1002877977 6:1227821-1227843 CCTGCCACCGATTTCCTAAAAAG No data
Right 1002877982 6:1227862-1227884 ACTTACTCTATAGATTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002877977 Original CRISPR CTTTTTAGGAAATCGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr