ID: 1002878615

View in Genome Browser
Species Human (GRCh38)
Location 6:1233019-1233041
Sequence TGCAGGGCGTTGATGGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002878609_1002878615 4 Left 1002878609 6:1232992-1233014 CCGGGCTGGGAAGACTCTCTGGG No data
Right 1002878615 6:1233019-1233041 TGCAGGGCGTTGATGGTTCTAGG No data
1002878603_1002878615 29 Left 1002878603 6:1232967-1232989 CCTGGGGATATGAAAGGAGAGGA No data
Right 1002878615 6:1233019-1233041 TGCAGGGCGTTGATGGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002878615 Original CRISPR TGCAGGGCGTTGATGGTTCT AGG Intergenic
No off target data available for this crispr