ID: 1002878839

View in Genome Browser
Species Human (GRCh38)
Location 6:1234579-1234601
Sequence CCACCTCCTTGAAGGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002878830_1002878839 1 Left 1002878830 6:1234555-1234577 CCAGCTCTTCACCCCAACGCCTC No data
Right 1002878839 6:1234579-1234601 CCACCTCCTTGAAGGTCTGATGG No data
1002878828_1002878839 3 Left 1002878828 6:1234553-1234575 CCCCAGCTCTTCACCCCAACGCC No data
Right 1002878839 6:1234579-1234601 CCACCTCCTTGAAGGTCTGATGG No data
1002878827_1002878839 6 Left 1002878827 6:1234550-1234572 CCTCCCCAGCTCTTCACCCCAAC No data
Right 1002878839 6:1234579-1234601 CCACCTCCTTGAAGGTCTGATGG No data
1002878829_1002878839 2 Left 1002878829 6:1234554-1234576 CCCAGCTCTTCACCCCAACGCCT No data
Right 1002878839 6:1234579-1234601 CCACCTCCTTGAAGGTCTGATGG No data
1002878826_1002878839 16 Left 1002878826 6:1234540-1234562 CCTCTGAGCTCCTCCCCAGCTCT No data
Right 1002878839 6:1234579-1234601 CCACCTCCTTGAAGGTCTGATGG No data
1002878831_1002878839 -10 Left 1002878831 6:1234566-1234588 CCCCAACGCCTCCCCACCTCCTT No data
Right 1002878839 6:1234579-1234601 CCACCTCCTTGAAGGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002878839 Original CRISPR CCACCTCCTTGAAGGTCTGA TGG Intergenic