ID: 1002880031

View in Genome Browser
Species Human (GRCh38)
Location 6:1242970-1242992
Sequence CTGGGAAGAAGCAGAGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002880018_1002880031 28 Left 1002880018 6:1242919-1242941 CCTGAAAGAACAGAGTCCCAGGA No data
Right 1002880031 6:1242970-1242992 CTGGGAAGAAGCAGAGCTGGAGG No data
1002880020_1002880031 12 Left 1002880020 6:1242935-1242957 CCCAGGAAGGAGAAAGCCCTTCT No data
Right 1002880031 6:1242970-1242992 CTGGGAAGAAGCAGAGCTGGAGG No data
1002880021_1002880031 11 Left 1002880021 6:1242936-1242958 CCAGGAAGGAGAAAGCCCTTCTG No data
Right 1002880031 6:1242970-1242992 CTGGGAAGAAGCAGAGCTGGAGG No data
1002880024_1002880031 -5 Left 1002880024 6:1242952-1242974 CCTTCTGCCTGCCCATGCCTGGG No data
Right 1002880031 6:1242970-1242992 CTGGGAAGAAGCAGAGCTGGAGG No data
1002880022_1002880031 -4 Left 1002880022 6:1242951-1242973 CCCTTCTGCCTGCCCATGCCTGG No data
Right 1002880031 6:1242970-1242992 CTGGGAAGAAGCAGAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002880031 Original CRISPR CTGGGAAGAAGCAGAGCTGG AGG Intergenic
No off target data available for this crispr