ID: 1002882584

View in Genome Browser
Species Human (GRCh38)
Location 6:1265986-1266008
Sequence TCGTTCCAGTGTAAGGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002882584_1002882590 22 Left 1002882584 6:1265986-1266008 CCACTGACCTTACACTGGAACGA No data
Right 1002882590 6:1266031-1266053 ATGCCAATCGTCTTGCAGGTAGG No data
1002882584_1002882589 18 Left 1002882584 6:1265986-1266008 CCACTGACCTTACACTGGAACGA No data
Right 1002882589 6:1266027-1266049 TGTGATGCCAATCGTCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002882584 Original CRISPR TCGTTCCAGTGTAAGGTCAG TGG (reversed) Intergenic
No off target data available for this crispr