ID: 1002884342

View in Genome Browser
Species Human (GRCh38)
Location 6:1280720-1280742
Sequence GTTTAAAGGGGGAATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002884330_1002884342 23 Left 1002884330 6:1280674-1280696 CCACGCGAGCTGGACTCCGCTTT No data
Right 1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG No data
1002884331_1002884342 7 Left 1002884331 6:1280690-1280712 CCGCTTTGATTTGTGCAGAGAGG No data
Right 1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG No data
1002884329_1002884342 24 Left 1002884329 6:1280673-1280695 CCCACGCGAGCTGGACTCCGCTT No data
Right 1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG No data
1002884328_1002884342 25 Left 1002884328 6:1280672-1280694 CCCCACGCGAGCTGGACTCCGCT No data
Right 1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002884342 Original CRISPR GTTTAAAGGGGGAATGAGGG AGG Intergenic
No off target data available for this crispr