ID: 1002885370

View in Genome Browser
Species Human (GRCh38)
Location 6:1289323-1289345
Sequence CTGTCCTGCTTTAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002885370_1002885388 26 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885388 6:1289372-1289394 GGCCCAGCTTGGGTCCCACCAGG No data
1002885370_1002885386 15 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885386 6:1289361-1289383 TGGGGGATTGGGGCCCAGCTTGG No data
1002885370_1002885380 -3 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885380 6:1289343-1289365 CAGGTGCCAAGGGGGACATGGGG No data
1002885370_1002885383 3 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885383 6:1289349-1289371 CCAAGGGGGACATGGGGGATTGG No data
1002885370_1002885387 16 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885387 6:1289362-1289384 GGGGGATTGGGGCCCAGCTTGGG No data
1002885370_1002885379 -4 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885379 6:1289342-1289364 ACAGGTGCCAAGGGGGACATGGG No data
1002885370_1002885378 -5 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885378 6:1289341-1289363 GACAGGTGCCAAGGGGGACATGG No data
1002885370_1002885384 4 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885384 6:1289350-1289372 CAAGGGGGACATGGGGGATTGGG No data
1002885370_1002885385 5 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885385 6:1289351-1289373 AAGGGGGACATGGGGGATTGGGG No data
1002885370_1002885381 -2 Left 1002885370 6:1289323-1289345 CCATCTTCCCTAAAGCAGGACAG No data
Right 1002885381 6:1289344-1289366 AGGTGCCAAGGGGGACATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002885370 Original CRISPR CTGTCCTGCTTTAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr