ID: 1002887874

View in Genome Browser
Species Human (GRCh38)
Location 6:1312192-1312214
Sequence CCTTCAGCCTTGAGCACCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887874_1002887877 -3 Left 1002887874 6:1312192-1312214 CCGCGGGTGCTCAAGGCTGAAGG No data
Right 1002887877 6:1312212-1312234 AGGCGCCGGACCTTCCCCCACGG No data
1002887874_1002887878 0 Left 1002887874 6:1312192-1312214 CCGCGGGTGCTCAAGGCTGAAGG No data
Right 1002887878 6:1312215-1312237 CGCCGGACCTTCCCCCACGGTGG No data
1002887874_1002887885 16 Left 1002887874 6:1312192-1312214 CCGCGGGTGCTCAAGGCTGAAGG No data
Right 1002887885 6:1312231-1312253 ACGGTGGCACGCACATCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887874 Original CRISPR CCTTCAGCCTTGAGCACCCG CGG (reversed) Intergenic