ID: 1002887878

View in Genome Browser
Species Human (GRCh38)
Location 6:1312215-1312237
Sequence CGCCGGACCTTCCCCCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887874_1002887878 0 Left 1002887874 6:1312192-1312214 CCGCGGGTGCTCAAGGCTGAAGG No data
Right 1002887878 6:1312215-1312237 CGCCGGACCTTCCCCCACGGTGG No data
1002887870_1002887878 16 Left 1002887870 6:1312176-1312198 CCTCGGGGACTCGCCTCCGCGGG No data
Right 1002887878 6:1312215-1312237 CGCCGGACCTTCCCCCACGGTGG No data
1002887873_1002887878 3 Left 1002887873 6:1312189-1312211 CCTCCGCGGGTGCTCAAGGCTGA No data
Right 1002887878 6:1312215-1312237 CGCCGGACCTTCCCCCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887878 Original CRISPR CGCCGGACCTTCCCCCACGG TGG Intergenic