ID: 1002887879

View in Genome Browser
Species Human (GRCh38)
Location 6:1312217-1312239
Sequence TGCCACCGTGGGGGAAGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887879_1002887889 24 Left 1002887879 6:1312217-1312239 CCGGACCTTCCCCCACGGTGGCA No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887879_1002887890 25 Left 1002887879 6:1312217-1312239 CCGGACCTTCCCCCACGGTGGCA No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887879_1002887885 -9 Left 1002887879 6:1312217-1312239 CCGGACCTTCCCCCACGGTGGCA No data
Right 1002887885 6:1312231-1312253 ACGGTGGCACGCACATCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887879 Original CRISPR TGCCACCGTGGGGGAAGGTC CGG (reversed) Intergenic