ID: 1002887882

View in Genome Browser
Species Human (GRCh38)
Location 6:1312227-1312249
Sequence ATGATGTGCGTGCCACCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887882_1002887895 22 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887895 6:1312272-1312294 AAGACGCCCGCGCGGGACCTGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1002887882_1002887889 14 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887882_1002887890 15 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887882_1002887894 21 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887894 6:1312271-1312293 GAAGACGCCCGCGCGGGACCTGG 0: 1
1: 0
2: 1
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887882 Original CRISPR ATGATGTGCGTGCCACCGTG GGG (reversed) Intergenic
907572124 1:55492972-55492994 ATTATGTTCTAGCCACCGTGGGG - Intergenic
912953795 1:114138433-114138455 ATGAAGTGGGTGCCACATTGAGG - Intronic
1065322390 10:24521658-24521680 AAGATGTGTGAGCCACCCTGTGG + Intronic
1072129321 10:92477536-92477558 CTGCTTTGCGTGCCACCATGTGG - Intronic
1073304678 10:102493651-102493673 ATGAAGTGCATGCCACCTCGTGG - Intronic
1074270369 10:111947656-111947678 CTGATGGGCATGCCACCATGTGG - Intergenic
1077186992 11:1239849-1239871 ATGAAGTGCGTGGCCCAGTGTGG + Exonic
1099976003 12:89546097-89546119 ATGCTGTGTGTGACACCATGGGG + Intergenic
1113959518 13:114118900-114118922 GGGGTGTGGGTGCCACCGTGGGG + Intronic
1121230789 14:92356406-92356428 AGAATGAGCGTGCCACCATGAGG + Intronic
1122156707 14:99754368-99754390 ACGCCATGCGTGCCACCGTGGGG - Intronic
1134681330 16:16127820-16127842 ATGGCGTGAGTGCCCCCGTGAGG + Intronic
1135605644 16:23822017-23822039 ATGTTGTGCGTACCGCTGTGGGG + Intergenic
1148103196 17:45105207-45105229 ATGATCTTCGTGCTACTGTGTGG - Intronic
1158318602 18:56238893-56238915 ATGAAGTGTGTGCCATCGTGAGG - Intergenic
1160407918 18:78655436-78655458 GTGTTTTGGGTGCCACCGTGGGG + Intergenic
1163170861 19:15530154-15530176 ATGATGGGCGTGCCACGGCCAGG - Intronic
1168394332 19:56035404-56035426 ATGCTGTGCCTGACATCGTGTGG + Intronic
1168520858 19:57049606-57049628 AGCATGTGCCTGCCGCCGTGAGG + Intergenic
925265587 2:2564315-2564337 ATAATGTGCATGACACTGTGTGG - Intergenic
929870423 2:45754621-45754643 ATGCTGTGCCTGCCCCCTTGAGG + Intronic
1169913666 20:10667229-10667251 AGGATGTGCGTGCCGCCGGCGGG - Intronic
1172132450 20:32664709-32664731 ATGGTGTGGGTGGCAGCGTGTGG - Intergenic
1174405084 20:50297641-50297663 AGGATGTGCGGGCCATGGTGAGG - Intergenic
1179006434 21:37519418-37519440 ATGCTGTGCATGCCTCAGTGAGG + Intergenic
1184585527 22:45445449-45445471 ATGATTCGGGTGCCACTGTGGGG - Intergenic
987012841 5:13784674-13784696 ATGATTTAGGTTCCACCGTGAGG - Intronic
989769905 5:45131634-45131656 ATGAAGTGTGTGTTACCGTGTGG - Intergenic
992844329 5:80730047-80730069 TTGATGTGCGTTCTCCCGTGTGG + Intronic
1002887882 6:1312227-1312249 ATGATGTGCGTGCCACCGTGGGG - Intergenic
1012935105 6:105359315-105359337 ATGATGTGAGTGCCAGAGAGGGG + Intronic
1019010901 6:168842728-168842750 GTGATGTGTGTGACACCATGTGG + Intergenic
1026860402 7:73783535-73783557 TTTATGTGCGTGCCACCATTTGG + Intergenic
1040365089 8:46707169-46707191 ATGTTGTGGCTGCCACCCTGTGG - Intergenic
1059239279 9:112789197-112789219 AGGATGTGCATGCCACCTGGAGG - Intronic
1061750401 9:132773041-132773063 GTGATGTGGGAGCCACTGTGTGG - Intronic
1185615145 X:1417337-1417359 GTGATGTGTGTGCATCCGTGTGG - Intronic
1200059045 X:153475966-153475988 AGGAGGTGGGAGCCACCGTGTGG - Intronic