ID: 1002887882

View in Genome Browser
Species Human (GRCh38)
Location 6:1312227-1312249
Sequence ATGATGTGCGTGCCACCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887882_1002887894 21 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887894 6:1312271-1312293 GAAGACGCCCGCGCGGGACCTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1002887882_1002887889 14 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887882_1002887890 15 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887882_1002887895 22 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887895 6:1312272-1312294 AAGACGCCCGCGCGGGACCTGGG 0: 1
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887882 Original CRISPR ATGATGTGCGTGCCACCGTG GGG (reversed) Intergenic