ID: 1002887883

View in Genome Browser
Species Human (GRCh38)
Location 6:1312228-1312250
Sequence GATGATGTGCGTGCCACCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887883_1002887889 13 Left 1002887883 6:1312228-1312250 CCCACGGTGGCACGCACATCATC No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887883_1002887895 21 Left 1002887883 6:1312228-1312250 CCCACGGTGGCACGCACATCATC No data
Right 1002887895 6:1312272-1312294 AAGACGCCCGCGCGGGACCTGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1002887883_1002887890 14 Left 1002887883 6:1312228-1312250 CCCACGGTGGCACGCACATCATC No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887883_1002887894 20 Left 1002887883 6:1312228-1312250 CCCACGGTGGCACGCACATCATC No data
Right 1002887894 6:1312271-1312293 GAAGACGCCCGCGCGGGACCTGG 0: 1
1: 0
2: 1
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887883 Original CRISPR GATGATGTGCGTGCCACCGT GGG (reversed) Intergenic
No off target data available for this crispr